Structural and functional diversity of Bacillus thuringiensis toxins on animal, plant and microbial cells
NAGIOS: RODERIC FUNCIONANDO

Structural and functional diversity of Bacillus thuringiensis toxins on animal, plant and microbial cells

DSpace Repository

Structural and functional diversity of Bacillus thuringiensis toxins on animal, plant and microbial cells

Show simple item record

dc.contributor.advisor Talaei-Hassanloui, Reza
dc.contributor.advisor Escriche Soler, Baltasar
dc.contributor.advisor Bel Cortés, Yolanda
dc.contributor.author Khorramnejad, Ayda
dc.contributor.other Departament de Genètica es_ES
dc.date.accessioned 2018-12-13T12:57:00Z
dc.date.available 2019-11-18T05:45:05Z
dc.date.issued 2018 es_ES
dc.date.submitted 18-11-2018 es_ES
dc.identifier.uri http://hdl.handle.net/10550/68267
dc.description.abstract Debido a los efectos nocivos de los insecticidas químicos en los ecosistemas y sobre los organismos beneficiosos, la implementación de agentes de control biológico ha recibido considerable atención. Entre los agentes de control biológico, se ha dedicado gran interés a los entomopatógenos, debido a su potencial para controlar plagas agrícolas y domésticas, vectores de enfermedades humanas y animales, sin introducir material no degradable en el medio ambiente. Bacillus thuringiensis (Bt) es el agente de control microbiano comercial más utilizado en la actualidad, con efectividad contra diferentes especies de insectos plaga. Las cepas de Bt producen cristales paraesporales proteináceos durante la fase de esporulación del crecimiento bacteriano llamados proteínas δ-endotoxina o Cry (de cristal). Además, esta bacteria, durante la fase de crecimiento vegetativo, produce otro tipo de proteínas insecticidas, como son las Cry1I, Vip y Sip. Las proteínas Cry1I no forman parte del cristal Bt, pero también se denominan "Cry" porque comparten una estructura de 3 dominios con la mayoría de las proteínas cristalinas. Las proteínas insecticidas Cry de Bt son altamente selectivas, no tóxicas para los vertebrados y rápidamente degradables. Debido a estas características, Bt ha ganado una gran importancia en el control de plagas de insectos agrícolas y muchos estudios se han centrado, en el pasado y presente, en el aislamiento y la caracterización de nuevas cepas que puedan conducir a encontrar nuevas toxinas con un espectro de actividad más amplio y mayor toxicidad insecticida. Objectivos La importancia de Bt en el control biologico de plagas, hizo que esta tesis tuviese los siguientes objetivos: - - Caracterización de nuevos aislados de Bt iraníes - - Expresión, aislamiento y purificación de nuevas proteínas insecticidas (Cry1Ia) - - Evaluación de la actividad insecticida y citotóxica de las toxinas Cry1Ia - - Estudio de la oligomerización en el modo de acción de las proteínas Cry1Ia - - Evaluación de la actividad antimicrobiana de las cepas Bt. - Determinación de los efectos bioquímicos de las cepas de Bt en células vegetales De acuerdo con estos objetivos, la tesis se ha dividido en seis partes principales que corresponden a cada uno de ellos.  Materiales y Métodos Los materiales y métodos generales utilizados en este trabajo se describen a continuación. Las metodologías específicas utilizadas para alcanzar cada uno de los seis objetivos principales de esta tesis, se describirán posteriormente, bajo el título de cada uno de ellos. - Cepas bacterianas En este estudio se utilizaron un total de 130 cepas de Bt iraníes, del stock de Bt del Biological Control Laboratory (Universidad de Teherán). Además, las cepas B. thuringiensis HD1 (HD1S2005, proporcionada por Valent Bioscience, Inc., Libertyville, IL, EE. UU.) y B. thuringiensis subesp thuringiensis HD2 (Berliner, obtenida del Bacillus Genetic Stock Centre, BGSC, Universidad Estatal de Ohio, Ohio, EE. UU.), se usaron como cepas de referencia. Las cepas DHα5 y BL21 (DE3) de Escherichia coli se emplearon para la clonación de genes y la expresión de proteínas. - Cría de insectos Para realizar los experimentos de toxicidad (bioensayos) y los ensayos de formación de oligómeros, se utilizaron ocho especies de lepidópteros plaga y una de coleópteros. Las especies de insectos lepidópteros utilizados en los bioensayos fueron Spodoptera exigua, S. littoralis, Mamestra brassicae y Helicoverpa armígera, que pertenecen a la familia Noctuidae, y Grapholita molesa, Plodia interpunctella y Ostrinia nubilalis, que pertenecen a las familias Tortricidae, Pyralidae y Crambidae, respectivamente. Lobesia botrana (Tortricidae), O. nubilalis y el coleóptero Leptinotarsa decemlineata (familia Chrysomelidae), se usaron para la preparación de vesículas de membrana de borde en cepillo (BBMV) y la realización de los ensayos de formación de oligómeros. Todas las colonias de insectos se criaron en dieta artificial y se mantuvieron a 25 ± 1 °C, humedad relativa (HR) de 70 ± 5% y con fotoperiodo de 16:8 horas de luz/oscuridad (L/O). - Líneas celulares de insecto Se utilizaron cuatro líneas celulares: BTI-Tn-5B1-4 (Hi5) de células de ovario de Trichoplusia ni, RP-HzGUTAW1 (HzGUT) de células de intestino de Helicoverpa zea , UCR-SE de S. exigua y Sf21 (de células de ovario de S. frugiperda). Las líneas celulares se cultivaron en medios de cultivo celular apropiados y se mantuvieron en las condiciones recomendadas por los proveedores. - Preparación de vesículas de membrana de borde en cepillo (BBMV) Las vesículas de membrana de borde en cepillo (BBMV) se realizaron a partir de intestinos de larvas de último estadio de O. nubilalis y L. decemlineata, o de larvas enteras de L. botrana, mediante el método de precipitación diferencial con magnesio (Wolfersberger et al., 1987), modificado por Escriche et al., (1995). Las BBMV se cuantificaron mediante Bradford y se almacenaron a -80 ° C hasta su uso. - Producción, solubilización y activación de protoxinas Las cepas de B. thuringiensis se crecieron en medio CCY y se incubaron 2 días a 29°C. La producción y la solubilización de las proteínas cristalinas de Bt se realizó según lo descrito por Estela. et al., (2004). La concentración de proteína se determinó mediante el ensayo de Bradford (Bradford, 1976). La activación de la protoxina se llevó a cabo añadiendo 10% de tripsina e incubando la muestra 2 horas a 37 ° C. Las proteínas solubilizadas y activadas se analizaron mediante electroforesis en gel de poliacrilamida al 12% con dodecilsulfato sódico (SDS-PAGE) siguendo Laemmli 1970. - Expresión, purificación y activación de proteínas Cry clonadas La proteína Cry1Ab se obtuvo de una cepa recombinante de E. coli GG094-208 (Dr. R. A. de Maagd, Universidad de Wageningen, Países Bajos). La proteína Cry1Ia7 (Martínez et al., 2004), fue cedida por el Dr. Primitivo Caballero (Universidad Pública de Navarra, Pamplona, España). Las proteínas Cry1Ia38, Cry1Ia38-I116V y Cry1Ia7 se expresaron en las células recombinantes de E. coli, BL21 (DE3) en esta tesis. La expresión, purificación, solubilización y activación de Cry1Ab, se realizó siguiendo Sayyed et al. (2005). La purificación de la toxina activada se realizó por cromatografía de intercambio aniónico con una columna MonoQ 5/5 usando el Äkta 100 Explorer (GE Healthcare, Reino Unido). Las fracciones eluidas se analizaron individualmente mediante SDS-PAGE. La expresión de las proteínas Cry1Ia38, Cry1Ia38-I116V y Cry1Ia7 en células BL21 (DE3) de E. coli, su purificación por cromatografía de afinidad usando columnas HisTrapTM FF crude (GE Healthcare Bio-Sciences, Upsala, Suecia), diálisis y activación con tripsina, se realizaron según Khorramnejad et al. (2018). Las concentraciones de Cry1Ab, Cry1Ia38, Cry1Ia38-I116V y Cry1Ia7, se estimaron por densitometría mediante el programa TotalLab Quant, version 12.3, usando BSA (albúmina de suero bovino) como estándar. Metodología específica por objetivos Primera parte: Caracterización de cepas Iraníes de B. thuringiensis Aislamiento de las cepas de Bt Se usó el método de selección con acetato para aislar, inicialmente, cepas Bt de diferentes muestras. El acetato de sodio inhibe selectivamente la germinación de esporas de Bt. Las esporas germinadas y otras bacterias no esporulantes, se eliminaron por tratamiento térmico (7 min a 80 ºC). Posteriormente las muestras se plaquearon en agar nutritivo y se dejaron crecer o/n a 29 °C. Las colonias obtenidas se examinaron mediante tinción de Gram y se observó la presencia de cristales paraesporales mediante microscopía de contraste de fases. Los aislados de Bt se clasificaron como tales tras observar su capacidad de producir cristales paraesporales. Bioensayos La selección preliminar de las cepas de Bt, se realizó observando su toxicidad contra larvas de segundo estadio de P. interpunctella. Los bioensayos se realizaron con una concentración única discriminante de 108 células/ml (superior a la CL50 calculada) mediante el método de incorporación en dieta. Los ensayos se llevaron a cabo utilizando 20 larvas, con tres repeticiones. Como control negativo se usó agua. La mortalidad se registró tras 72 horas de tratamiento. Como resultado, se seleccionaron siete cepas de Bt y se bioensayaron contra larvas neonatas de S. exigua, G. molesta, O. nubilalis y M. brassicae por el método de contaminación de la dieta en superficie (Hernández-Martínez et al., 2008). Los bioensayos se realizaron con protoxinas y toxinas activadas, y se repitieron tres veces, con 48 larvas por réplica. El tampón de solubilización y HD1 se usaron como control negativo y cepa de referencia, respectivamente. Los bioensayos se realizaron a 25 ± 1°C, 60 ± 5% HR y 16:8 L/O. La mortalidad se registró a los 7 días. - Ensayos de viabilidad celular La viabilidad celular se registró usando CellTiter 96® AQueous One Solution Reagent (Promega Co., Madison, WI, EE. UU.), basado en la detección de la reducción de sal de tetrazolio (MTT- 3- (4,5-Dimetil-2-tiazolil) 2,5-difenil-2H). Los ensayos se realizaron utilizando cuatro líneas celulares de los lepidópteros T. ni (Hi5), H. zea (HzGUT), S. exigua (UCR-SE) y S. frugiperda (Sf21). La actividad citotóxica fue investigada mediante observación microscópica, ensayo de dosis única y ensayo de dosis-respuesta. Para determinar dicha actividad, se realizó un ensayo de dosis única con las proteínas de los cristales de las cepas Bt seleccionadas solubilizadas y activadas, frente a cada una de las cuatro líneas celulares. Posteriormente, se realizaron ensayos de dosis-respuesta para las cepas más tóxicas contra las líneas celulares de insectos más susceptibles. Para los ensayos de dosis única, se usaron 10 μg de proteína solubilizada o 7 μg de toxina activada. Para el ensayo de dosis-respuesta, las células se trataron con diferentes concentraciones de toxina (0,64, 3,2, 16, 80 y 400 μg/ml). Los cambios morfológicos inducidos por las toxinas se registraron tras observación microscópica (Leica DMI 3000B), en diferentes tiempos (1, 3, 6 y 16 horas) después de la exposición a la toxina. La viabilidad celular se midió 16 horas después de tratar las células en los ensayos de dosis única, y 6 horas después de la exposición en ensayos de dosis-respuesta. Todos los experimentos se realizaron por duplicado y se repitieron dos veces. Perfil proteico y análisis proteómico Las proteínas activadas y solubilizadas se analizaron mediante SDS-PAGE (Laemmli 1970) para obtener el perfil proteico. Técnicas de cromatografía líquida y espectrometría de masas en tándem (LC-MS / MS) realizadas en la instalación de proteómica del SCSIE ( Servei Central de Apoyo a la Investigación Experimental), en la Universitat de València (Valencia, España) se utilizaron para la obtención del prefil proteómico. - Identificación del contenido génico El ADN total de cada cepa Bt seleccionada se extrajo y purificó siguiendo Ferrandis et al. (1999). Las cepas se caracterizaron genéticamente usando 27 pares de cebadores diseñados en este trabajo o descritos previamente en la bibliografía. Los productos de PCR se analizaron mediante electroforesis en gel de agarosa al 1%. El ADN amplificado se purificó usando NucleoSpin Gel y kit de limpieza de productos de PCR (MACHEREY-NAGEL, Alemania) y se secuenció (Stab Vida, Investigación y Servicios en Ciencias Biológicas Lda, Portugal). Las secuencias fueron editadas y analizadas utilizando Geneious (versión 10.0.9). Los análisis de la secuencia de ADN se realizaron usando la base de datos NCBI. - Production de β-exotoxina La posible presencia de β-exotoxina en las cepas de Bt se determinó mediante LC-MS / MS. La preparación de la muestra se realizó según lo descrito por Hernández et al. 2003. Segunda Parte: Aislamiento, clonación, expresion y purificación de nuevas proteínas insecticidas La caracterización exhaustiva de la cepa IE-1 (aislada de las larvas infectadas de Ephesia kuehniela) dio lugar al descubrimiento de un nuevo gen tipo cry1Ia, que fue denominado cry1Ia38 (Gene Bank Acc. Number MG584186). Clonaje del gen cry1Ia38 El gen completo cry1Ia38 se clonó a partir del ADN genómico extraído de la cepa IE-1. Los cebadores utilizados para la amplificación del gen por PCR fueron Ia38-F (5'GGATCCATGAAACTAAAGAATCAAGAT 3') e Ia38-R (5'GTCGACCTACATGTTACGTTACGCTCAATC 3'). Después de la amplificación, los productos de PCR se clonaron en el vector de clonación pGEM-Teasy. Posteriormente, el gen cry1Ia38 clonado se subclonó en el vector de expresión, pET-30a (+). La construcción resultante se transformó en células E. coli DHα5. La secuencia insertada se confirmó mediante secuenciación con iniciadores de inserción, en ambas direcciones. Después de la secuenciación, los transformantes exitosos se transformaron en células E. coli BL21 (DE3) para su expresión. La proteína Cry1Ia38 producida se purificó por cromatografía de afinidad (ver "Expresión, purificación y activación de proteínas Cry clonadas"). - Mutagénesis dirigida La sustitución de Ile116 por Val en la posición 116 se realizó mediante PCR de solapamiento-extensión, usando el gen cry1Ia38 clonado en pET-30a (+) como molde. La secuenciación del ADN verificó la mutación puntual. Tercera parte: Investigación de las propiedades insecticidas y citotóxicas de las toxinas Cry1Ia La caracterización molecular, actividades insecticidas y citotóxicas de la protoxina Cry1Ia38 y de la proteína activada, se estudiaron usando larvas neonatas de O. nubilalis, G. molesta, H. armigera, S. exigua y S. ittoralis, a una concentración de 1000 ng / cm2 por el método de contaminación en superficie. Además, las actividades citotóxicas de Cry1Ia38 protoxina y de toxina se determinaron contra la línea celular Sf21, usando cuatro concentraciones diferentes (0,16, 0,8, 4 y 20 μg / ml). La actividad insecticida de Cry1Ia38-I116V (protoxina y toxina activada) se evaluó contra neonatos de O. nubilalis, S. exigua, G. molesta y S. littoralis a 1000 ng / cm2, como se ha descrito anteriormente. Las actividades citotóxicas también se determinaron contra la línea celular Sf21, a las cuatro concentraciones usadas para Cry1Ia38. Para comparar las actividades insecticidas con otras proteínas Cry1Ia, se escogió la toxina Cry1Ia7, previamente analizada y clonada, y disponible en el Laboratorio de Control Biotecnológico de Plagas (Departamento de Genética, Universitat de València), donde se ha realizado esta tesis. La secuencia de aminoácidos de Cry1Ia38 fué 96% idéntica a la deCry1Ia7. La actividad insecticida se evaluó frente a larvas de primer estadio de O. nubilalis, G. molesta, M. brassicae y S. littoralis, a 1000 ng / cm2 similarmente a Cry1Ia38. La actividad citotóxica a cuatro concentraciones diferentes (0.16, 0.8, 4 y 20 μg / ml) también fue evaluada contra dos líneas celulares de insectos, Sf21 y Hi5. Cuarta parte: Estudio de la oligomerización en el modo de acción de las proteínas Cry1Ia - Marcaje de Cry1Ia con biotina La proteína Cry1Ia activada se marcó utilizando kit para marcaje con biotina de GE Healthcare (GE Healthcare, Little Chalfont, United Kingdom), siguiendo las instrucciones del fabricante, como describió Hernández-Martínez et al. (2014). - Ensayos de oligomerización con células Sf21. Los ensayos de oligomerización se realizaron según lo descrito por Portugal et al (2014) con ligeras modificaciones. En resumen, 100 μl de suspensión celular (2x106 células / ml) se trató con toxinas activadas (Cry1Ia biotinilada y Cry1Ab) a una concentración final de 0,03 μg proteína / μl. Las placas se incubaron durante 3 horas a 25 ° C. Posteriormente, las células se recogieron por centrifugación a 16.200 × g, 4 ° C durante 15 minutos, se lavaron con 200 μl de tampón de carbonato 50 mM pH 10.5 y se recuperaron tras centrifugación durante 45 min a 18.800 × g. Las células se resuspendieron en 10 μl de tampón y se calentaron a 50 ºC, 3 minutos. Las proteínas presentes en la muestra se separaron por SDS-PAGE al 10% y se electrotransfirieron a una membrana de difluoruro de polivinilideno (PVDF). La membrana se bloqueó o/n en PBS con Tween 20 al 0,1% (PBST) suplementado con leche desnatada al 5% con agitación suave. Tras tres lavados con PBST, la membrana se incubó con anticuerpos: Cry1Ab se detectó con anticuerpo policlonal anti-Bt Cry1Ab / 1Ac de conejo (Abraxis Warminster, Pennsylvania, Estados Unidos) (1: 10.000, 60 min) de seguido de anticuerpo secundario (1: 20,000; 60 min) acoplado con con peroxidasa de rábano picante (HRP) mientras que la proteína Cry1Ia biotinilada fue detectada con HRP conjugada con estreptavidina (1: 2.000; 60 min). Ambas proteínas Cry1Ab y Cry1Ia se visualizaron por quimioluminiscencia utilizando el reactivo ECLTM (GE Healthcare) y el analizador de imágenes ImageQuant LAS400. Cada ensayo de oligomerización se repitió al menos tres veces. - Ensayos de oligomerización con BBMV. Los ensayos se realizaron siguiendo Ocelotl et al (2015) con algunas modificaciones: 2 μg de Cry1Ia marcada con biotina o Cry1Ab activada se incubaron, durante una hora con 5 μg de BBMV de L. botrana o L. decemlineata, o con 20 μg de BBMV de O. nubilalis, a 37 ° C, en un volumen final de 50 μl. Proteínas activadas incubadas en ausencia de BBMV y muestras que contenían solo BBMV, se usaron como controles. El resto del experimento se llevó a cabo como se ha expuesto en la sección anterior. Los ensayos se repitieron, al menos, tres veces. Quinta Parte: Evaluación de la actividad antimicrobiana de las cepas de Bt El efecto inhibidor de las cepas de Bt se evaluó frente al hongo fitopatógeno, F. oxysporum subsp. lycopersici, y a la bacteria Erwinia sp. La presencia de genes de endo y exoquitinasas se investigó por PCR utilizando dos pares de cebadores específicos. La actividad antibacteriana contra Erwinia sp. se analizó usando el método de difusión descrito por Djenane et al., (2017). La actividad antifúngica de las cepas Bt contra F. oxysporum subsp. lycopersici se estudió utilizando el método de cultivo dual (Knaak et al., 2007). Sexta Parte: Determinación de los cambios bioquímicos y fisiológicos provocados por Bt en las células vegetales - Mantenimiento de las plantas de tomate e inoculación bacteriana Plantas de tomate, Solanum lycopersicum L., (cultivar Falat), se desarrollaron y mantuvieron en condiciones controladas (25 ± 5°C, 16:8 horas (L/O), 65 ± 5% RH) en invernaderos, en suelo estéril autoclavado. Plántulas de tomate de dos semanas se transfirieron a macetas (dos plantas por tiesto) y se regaron diariamente con agua. Las plantas de seis semanas se dividieron en cuatro grupos: 1. Inoculación de la rizosfera, 2. Controles que recibieron agua destilada estéril en la rizosfera, 3. Inoculación de filoplano y 4. Controles cuyo filoplano fue rociado con agua destilada estéril. En dos tratamientos, las plantas se pulverizaron o inocularon con mezclas de esporas y cristales de la cepa AzLp. La inoculación de la rizosfera se hizo con pipetas, añadiendo 5 ml de una suspensión de 108 esporas / ml cerca de las raíces. En el tratamiento de pulverización, el suelo se cubrió con plástico para evitar la transferencia de la suspensión de Bt al suelo, y se realizó con una suspensión de 108 esporas / ml, hasta la escorrentía. Se usaron 28 tiestos de tomate en cada tratamiento, 96 tiestos en total. Después de 0 (2 horas tras la aplicación de Bt como 0 días), 1, 2, 3, 5, 7, 10 y 15 días después del tratamiento, se recogieron las hojas maduras, se molieron en nitrógeno líquido y se mantuvieron a -80 ° C hasta su uso. - Respuestas bioquímicas y fisiológicas de las plantas de tomate Las actividades enzimáticas catalasa, superóxido dismutasa, ascorbato peroxidasa, fenilalanina amoniaco-liasa y polifenol oxidasa y parámetros no enzimáticos (proteínas, carbohidratos, fenilalanina y contenido fenólico) se determinaron y compararon en hojas de plantas tratadas y no tratadas. Para medir las actividades enzimáticas, se homogeneizaron 0,5 g de hojas en 1 ml de tampón de fosfato 50 mM pH 6,8, seguido de centrifugación a 13000 x g 15 minutos a 4ºC. El sobrenadante se utilizó para la determinación de catalasa (Aebi 1984), superóxido dismutasa (Beauchaup y Fridovich, 1971), ascorbato peroxidasa (Ranieri et al., 2003) y polifenol oxidasa (Kar y Mishra, 1976). La actividad de la fenilalanina amoniaco-liasa se midió siguiendo el protocolo de Wang et al. (2006). El contenido de prolina se determinó mediante el uso de ninhidrina ácida (Carillo y Gibon, 2011). La estimación del contenido fenólico total se realizó mediante el uso de reactivo Folin-Ciocalteu (Ainsworth y Gillespie, 2007). El contenido de proteína y el hidrato de carbono total soluble se midieron como se describe en Bradford (1976) y Dreywood (1946), respectivamente.   Resultados y Discusión Primera parte: Caracterización de cepas iraníes de B. thuringiensis En este estudio se utilizaron 130 cepas de Bt: 88 procedentes de una colección de Bt del Laboratorio de Control Biológico de la Universidad de Teherán, y 42 aisladas de muestras de suelo y larvas de insectos infectados recogidos de localizaciones ambientalmente diversas en Irán. Se realizaron pruebas preliminares de selección con mezclas de esporas y cristales usando larvas de segundo estadio de P. intenpunctella. En base a estos resultados, las 130 cepas de Bt se clasificaron en función de su toxicidad en tres grupos de virulencia: alto, medio y bajo Cinco cepas de Bt aisladas de larvas infectadas (IE-1, AzLp, IE-2, IP-2 e IEp), así como otras dos cepas de Bt aisladas del suelo (DCf y MCh), se clasificaron en la primera categoría, causando una mortalidad de más del 67%. La mayoría de las cepas (119 cepas de Bt) no causaron mortalidad significativa (menos del 34%) y solo cuatro cepas mostraron actividad moderada (34% a 67% de mortalidad). A partir de estos resultados, siete cepas de Bt con diversa actividad larvicida (IE-1, AzLp, IE-2, IP-2 e IEp, altamente tóxicas y las cepas KhF y RM Bt que mostraron actividad respectivamente baja y no tóxica) fueron seleccionadas y caracterizadas con más detalle en este trabajo. El espectro de actividad tóxica se evaluó mediante bioensayos usando el método de contaminación superficial, utilizando larvas de primer estadio de los lepidópteros S. exigua, M. brassicae, G. molesta y O. nubilalis (que representan las familias Noctuidae, Tortricidae, Crambidae y Pyralidae de orden Lepidoptera) a una concentración de 1000 ng/cm2. G. molesta y O. nubilalis, fueron los insectos más susceptibles tanto a las protoxinas como a las toxinas activadas. Diversos grados de mortalidad se observaron cuando se usaron larvas de S. exigua y M. brassicae. Entre ellos, las protoxinas y las toxinas activadas de AzLp, IE-2 e IP-2 exhibieron los niveles más altos de toxicidad para estos dos insectos en comparación con las del estándar Bt HD-1. Para completar el análisis toxicidad, se realizaron ensayos in vitro con líneas celulares de lepidópteros (actividad citotóxica) de la familia Noctuidae. Las proteínas cristalinas de AzLp, IE-2 e IP-2 fueron las más tóxicas para todas las líneas celulares, especialmente para Sf21. Los ensayos in vitro indicaron que las cepas IE-1 y RM fueron poco tóxicas para todas las líneas celulares analizadas, similarmente a la cepa de referencia HD-1. Además, después de exponer las células Sf21 a diferentes concentraciones de toxinas activadas de AzLp IE-2 e IP-2, se observaron cambios morfológicos, como hinchado osmótico o células con forma de globo. El resultado de los ensayos mostró que al aumentar la concentración de toxina, la viabilidad de las células disminuía. Las cepas IE-2 e IP-2 exhibieron una actividad citotóxica estadísticamente similar, con EC50 de 1,03 y 1,60 μg / ml, respectivamente. Nuestros resultados mostraron que las cepas Bt seleccionadas presentaban perfiles proteicos similares en SDS-PAGE, compuestos por proteínas con pesos moleculares entre 130 y 20 kDa. Los perfiles de bandas fueron, generalmente, similares al de Bt HD-1 y consistieron principalmente en dos bandas de aprox. 130 (que podrían corresponder a proteínas de tipo Cry1) y sobre 65 kDa (probablemente correspondiente a proteínas de tipo Cry2 o Cry1 procesada). Tras la solubilización, las proteínas activadas con tripsina mostraron perfiles de bandas en prácticamente idénticos, evidenciando dos bandas mayoritarias de alrededor de 65 kDa. El análisis proteómico por LC-MS / MS mostró que las proteínas Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ca, Cry1Da y Cry2Aa eran las más abundantes en los cristales de las cepas Bt seleccionadas. Las proteínas de la familia Cry1A fueron las más abundantes según los valores cuantitativos. Cry1Ac fue la única proteína asignada a la cepa RM. Para la cepa KhF, no se identificó ninguna proteína similar a las proteínas cristalinas insecticidas Bt conocidas. El análisis de PCR se llevó a cabo para identificar los genes codificantes para proteínas Bt, tanto las secretadas durante la etapa vegetativa de Bt (genes cry1I, vip y sip) como las presentes en los cristales (genes cry, cyt y ps). Se observó que el gen cry2 estaba presente en todas las cepas probadas. Excluyendo KhF, las otras cepas produjeron los amplicones esperados en base a los resultados obtenidos en anteriormente. Las cepas IE-1, AzLp, IE-2, IP-2 e IEp mostraron amplificación por PCR positiva para los genes cry1Ac, cry1I, vip3. En ninguna de las cepas se amplificaron los genes cry1Ad, cry1Ag, cyt1, cyt2, vip1, vip2, sip1, ps1, ps2, ps3 o ps4. Como paso final en la caracterización, se investigó la producción de β-exotoxina, requisito necesario para proponer una nueva cepa de Bt como candidato para uso comercial. La β-exotoxina es tóxica para vertebrados, por lo que los bioinsecticidas basados en Bt que la producen están prohibidos. La presencia de β-exotoxina se determinó por LC-MS / MS en el sobrenadante del cultivo de Bt en fase vegetativa. Los resultados mostraron su ausencia en todas las cepas Bt seleccionadas, clasificándolas como aptas para futuros bioplaguicidas. En resumen, de un total de 130 cepas iraníes de Bt, 7 fueron seleccionadas para ser extensivamente caracterizadas empleando diferentes metodologías. Como resultado, debido a la alta toxicidad para diferentes larvas y líneas celulares de insectos, la presencia de proteínas insecticidas y la ausencia de β-exotoxina, las cepas AzLp, IE-2 e IP-2 se pueden proponer como candidatas para el desarrollo de nuevos bioinsecticidas basados en Bt. Segunda Parte: Aislamiento, clonación, expresión y purificación de nuevas proteínas insecticidas Debido a la extensa aplicación de productos basados en Bt, en algunos insectos plaga se han detectado brotes de resistencia. Se han empleado diversas estrategias para mejorar la eficacia de los insecticidas basados en Bt y el descubrimiento de nuevas cepas es necesario para descubrir nuevas toxinas con diferentes modos de acción y quizás un rango más amplio de actividad insecticida. En esta Tesis, en la búsqueda de nuevos genes cry que codifiquen nuevas toxinas, en la cepa IE-1se encontró un nuevo gen tipo cry1Ia. Fue llamado cry1Ia38 (Gene Bank Acc. Number MG584186), y se observó que tenía 2160 pb que codificaban una proteína de 719 aminoácidos. Éste gen se clonó a partir del ADN genómico extraído de la cepa IE-1 y se expresó en células de E. coli BL21. El gen codificó para una proteína de 80 kDa, masa molecular única entre las proteínas cristalinas de 3dominios y común a todas las toxinas Cry1I. La activación dió como resultado un péptido estable de aprox. 50 kDa. Posteriormente se comparó la toxicidad de Cry1Ia38 con la de un mutante puntual de ésta generado mediante mutagénesis dirigida, el Cry1Ia38-I116V, que tiene sustituída Ile por Val en la posición 116, en el dominio I de la proteína. La expresión de Cry1Ia38-I116V resultó en una protoxina de 80 kDa, que tras activarla se mostró como una banda de 50 kDa en SDS-PAGE. Tercera parte: Investigación de las propiedades insecticidas y citotóxicas de las toxinas Cry1Ia Los bioensayos mostraron que la protoxina Cry1Ia38 era altamente toxica para O. nubilalis y G. molesta, poco tóxica para S. exigua y S. littoralis, e inocua para H. armigera. La proteína Cry1Ia38 activada, resultó altamente tóxica para G. molesta y moderadamente tóxica O. nubilalis. En base a los ensayos de viabilidad celular, Cry1Ia38 (protoxina o toxina) no fue tóxica para las células Sf21 a las concentraciones probadas. La actividad insecticida de la protoxina y la proteína tripsinizada de Cry1Ia38-I116V, se deterninó frente a larvas de O. nubilalis, G. molesta y S. exigua y S. littoralis a una concentración de 1000 ng / cm2. La protoxina resultó tóxica para O. nubilalis y G. molesta, mientras que el mutante activado con tripsina perdió la toxicidad contra ambos insectos. Por lo tanto, los datos indican que la mutación afectó la actividad insecticida. De forma similar a lo que se había encontrado con Cry1Ia38, la protoxina y la toxina activada de Cry1Ia38-I116V no resultaron tóxicas para las células Sf21. La caracterización molecular y las actividades insecticidas y citotóxicas de Cry1Ia7 se analizaron y compararon con las proteínas obtenidas en el presente trabajo, Cry1Ia38 y Cry1Ia38-I116V. Nuestros resultados mostraron que la protoxina de Cry1Ia7 era tóxica para O. nubilalis y G. molesta. Pero la toxina activada dio una toxicidad menor que la de Cry1Ia38 para G. molesta. El ensayo de viabilidad celular mostró que Cry1Ia7 no era tóxica para las células Sf21 o Hi5 a las concentraciones probadas (no se observaron diferencias estadísticamente significativas entre ellas). Solo después de 48 horas de exposición a la concentración más alta de Cry1Ia7 activada (20 μg / ml), se observó una pérdida del 40% de la viabilidad celular en ambas líneas celulares. En resumen, en esta investigación se evaluó y comparó el espectro insecticida de diferentes proteínas Cry1Ia. De acuerdo con nuestros hallazgos, las protoxinas de Cry1Ia38 y Cry1Ia7 fueron tóxicas para las larvas de O. nubilalis y G. molesta. Pero la Cry1Ia7 activada con tripsina no mostró actividad insecticida contra las larvas de G. molesta, mientras que Cry1Ia38 sí lo hizo. Tomados en conjunto, aunque existe una alta identidad entre las secuencias de aminoácidos de las proteínas Cry1Ia probadas, se detectaron diferencias significativas en la actividad insecticida de las formas activadas por tripsina de estas toxinas, en aprticular, contra G. molesta. Cuarta parte: Estudio de la oligomerización en el modo de acción de las proteínas Cry1Ia El modo de acción de las toxinas Cry de Bt comienza por la ingestión de las inclusiones cristalinas paraesporales y su solubilización (por las condiciones de pH del intestino medio del insecto), convirtiéndolas en protoxinas. Éstas son activadas por las proteasas del intestino medio del huésped, produciendo núcleos resistentes a proteasas o toxinas. El modo de acción de las proteinas Cry de 3-dominios que componen el cristal paraesporal de Bt, no está totalmente dilucidado. De acuerdo con el modelo de unión secuencial, después de esta activación proteolítica, en el intestino los monómeros se unen a receptores de membrana tipo cadherina. Esta unión desencadena un segundo corte proteolítico que favorece la oligomerización de toxinas, y tras ello, su inserción en las membranas intestinales y la formación de poros. La formación de un oligoméro antes de la inserción en membrana se ha descrito como un paso importante necesario para el proceso de toxicidad. Debido a las características específicas de las proteínas Cry1I (las cuales tienen 3 dominios pero no forman cristal), una mejor comprensión de su modo de acción es fundamental para mejorar su eficacia frente a las plagas de insectos. En este estudio, se ha determinado por primera la vez formación de oligómeros de Cry1Ia y la posible relación entre éstos y su actividad insecticida. Dado que las proteínas Cry1I tienen actividad doble contra las plagas de lepidópteros y coleópteros, se estudió la formación de oligómeros de Cry1Ia7 después de incubar la proteína con BBMV del coleóptero susceptible L. decemlineata, del lepidóptero susceptible L. botrana, y del lepidóptero no susceptible O. nubilalis. Además, en este estudio se empleó la línea celular Sf21 como modelo derivado de células. Además, se seleccionó Cry1Ab como control debido a que su oligomerización ha sido demostrada en varios estudios. Nuestros resultados mostraron claramente que Cry1Ab puede oligomerizar en la forma de tetrámero propuesta por otros autores (tamaño de peso molecular de 250 kDa) tras entrar en contacto con BBMV o células de insectos independientemente de la susceptibilidad del huésped, ya que se observaron oligómeros después de la incubación de la proteína tripsinizada con BBMV de O. nubilalis o L. botrana (insectos susceptibles) , pero también con BBMV de L. decemlineata (no susceptible) y células Sf21 (células no susceptibles). Pero la toxina Cry1Ia formó oligómeros solo después de la incubación con BBMV de L. decemlineata (coleóptero susceptible) pero no después de la incubación con BBMV de lepidópteros o células, independientemente de su susceptibilidad. En base a nuestros resultados, el modelo de unión secuencial del modo de acción de las toxinas de Bt de tres dominios, que incluye la oligomerización, puede no ser general para todos los miembros de la familia Cry de tres dominios. Estos datos indican que posiblemente Cry1Ia tenga un modo de acción diferente a otras proteínas Cry, favoreciendo que puedan usarse en combinación con éstas últimas en insecticidas o plantas transgénicas, para retrasar la evolución de la resistencia en los insectos diana. Quinta Parte: Evaluación de la actividad antimicrobiana de las cepas de Bt Hasta ahora, solo las propiedades insecticidas de Bt atraían atención. Sin embargo, en los últimos años, se han descubierto otras acciones de Bt en el control de enfermedades de las plantas, ya que existen evidencias de una acción antibiótica de esporas y cristales de cepas de Bt sobre hongos y bacterias fitopatógenas. Encontrar una formulación basada en Bt específica, fácilmente degradable y de bajo coste para controlar tanto las plagas de insectos como las enfermedades de las plantas, sería altamente valiosa en el control biológico. En esta Tesis, se evaluó la actividad antimicrobiana de las siete cepas de Bt previamente seleccionadas, contra patógenos de plantas tales como el hongo F. oxysporum o la bacteria Erwinia sp. Además, se estudió el gen de quitinasa como un importante agente antifúngico en las cepas de Bt estudiadas. Nuestros resultados mostraron que las cepas IE-1, AzLp, IE-2, IP-2 e IEp poseen exoquitinasa. El gen de la endo-quitinasa se detectó en las cepas AzLp, IE-2 e IP-2. La actividad antifúngica de las siete cepas Bt se evaluó por el método de cultivo dual frente a F. oxysporum subsp. lycopersici que causa podredumbre de la raíz en plantas de tomate. El fitopatógeno creció en la superficie de placas de Agar de Dextrosa de Patata y las barreras bacterianas de Bt no inhibieron su crecimiento. Como resultado, se concluyó que la mezcla de esporas y cristales de las cepas de Bt seleccionadas no poseían actividades antifúngicas. No se observó correlación entre la presencia de genes de quitinasa y la actividad antifúngica, lo que podría explicarse por una baja transcripción del gen o por secuencias no transcritas. La actividad antibacteriana de las cepas Bt seleccionadas se probó por el método de difusión en agar, frente a la bacteria patógena Gram negativa, Erwinia sp.. La bacteria fitopatógena creció en toda la superficie de la placa de Agar Nutritivo y no se observaron zonas claras alrededor de las colonias de Bt, lo que indica que éstas no pudieron controlar Erwinia sp., que causa la enfermedad de pudredumbre blanda del tomate. La actividad antimicrobiana descrita en otras cepas de Bt podría ser una consecuencia de la adaptación de dichas cepas a su hábitat. Por lo tanto, debido a que la mayoría de las cepas de Bt estudiadas (IE-1, AzLp, IE-2, IP-2 e IEp) habían sido aisladas de larvas de insectos infectados o muertos, lo más probable es que no mostraran ninguna actividad antimicrobiana contra los agentes fitopatógenos utilizados en este estudio, usualmente presentes en el suelo (F. oxysporum subsp lycopersici y Erwinia sp). Sexta Parte: Determinación de los cambios bioquímicos y fisológicos provocados por Bt en las células vegetales Se ha descrito que cepas Bt tienen potencial para promover el crecimiento de las plantas, mejorar la absorción de nutrientes y protegerlas en condiciones de estrés abiótico y biótico. Bt puede proteger las plantas a través de la producción de sideróforos, actividad quitinasa, aumentando las actividades de las enzimas de resistencia de las plantas e induciendo la resistencia sistémica. Aunque los pesticidas basados en Bt se han usado ampliamente durante años, se sabe muy poco sobre la interacción entre las células vegetales y Bt. El objetivo de esta parte de la tesis fue estudiar la interacción planta-Bt a nivel celular, centrándonos en el efecto de la inoculación de Bt sobre el estado antioxidante de la planta. Cuando las plantas están sujetas a estrés biótico o abiótico, hay una producción de especies reactivas de oxígeno que dañan sus células. Por lo tanto, enzimas antioxidantes tales como catalasa, superóxido dismutasa, fenilalanina amoniaco-liasa y ascorbato peroxidasa son necesarias para eliminar dichas especies reactivas y restaurar las condiciones normales a nivel celular. Cuando las plantas sufren estrés biótico (como invasión de patógenos), se producen las reacciones oxidativas (superóxido, peróxido de hidrógeno y radicales hidroxilo) que desencadenan la defensa de la planta en dos fases; la fase uno es inespecífica y ocurre inmediatamente después del reconocimiento del patógeno, pero la fase dos se prolonga y conduce a la resistencia a la enfermedad. En este trabajo de Tesis, se estudió la actividad de los enzimas antioxidantes tras tratar plantas de tomate (rociando el filoplano o inoculando la rizosfera) con las cepas de Bt seleccionadas. El resultado fue un aumento significativo de dichas actividades, muy probablemente para reducir el estrés oxidativo. En el caso de tratar (en filoplano o rizosfera) las plantas de tomate con una mezcla de esporas y cristales de la cepa AzLp, se observaron estas dos fases. El tratamiento de plantas de tomate con suspensión de Bt (mezcla de esporas y cristales) tanto en filoplano como en rizosfera, mejoró significativamente la acumulación de proteínas, carbohidratos, prolina y contenido fenólico en hojas de tomate en comparación con el tratamiento no inoculado. Los componentes no enzimáticos, como la prolina, actúan como una defensa principal contra las especies reactivas de oxígeno. Por lo tanto, al aumentar los contenidos fenólicos, de carbohidratos, proteínas y prolina en las hojas de tomate, se disminuye el daño oxidativo. En conjunto, de acuerdo con nuestras observaciones, el impacto de la suspensión de Bt en las células de tomate condujo a respuestas fisiológicas y bioquímicas, que aumentaron la actividad de las enzimas antioxidantes y la resistencia inducida al estrés biótico. En resumen, nuestra investigación ha caracterizado extensivamente algunos aislados de Bt iraníes seleccionados según su toxicidad a P. interpunctella, mediante el uso de diferentes técnicas complementarias. La caracterización se realizó en base al perfil electroforético de proteínas, contenido de genes, análisis proteómico, perfil insecticida y citotóxico y producción de β-exotoxina. Esta caracterización integral ha revelado tres cepas Bt muy potentes para controlar plagas de lepidópteros. Siguiendo los objetivos de esta tesis, el efecto de las proteínas de las cepas de Bt seleccionadas se evaluó usando células animales (líneas celulares de insectos), células microbianas (cultivos de Erwinia sp. y Fusarium) y células vegetales (plantas de tomate). Para encontrar nuevas actividades insecticidas, se exploraron las cepas seleccionadas en busca de nuevos genes cry. Como resultado, se descubrió el gen cry1Ia38, y tanto éste como un mutante puntual de éste, se clonaron y expresaron. Las actividades insecticidas y citotóxicas de las proteínas Cry1I se evaluaron frente a diferentes especies de lepidópteros y líneas celulares de insectos. Los resultados de nuestros bioensayos mostraron que Cry1Ia38 en forma de protoxina o de toxina activada, tiene un gran potencial para controlar O. nubilalis y G. molesta. Finalmente, se realizaron estudios de biología molecular para estudiar la oligomerización de la proteína Cry1Ia. Nuestros hallazgos mostraron que la oligomerización no es un paso necesario en la toxicidad de estas proteínas. es_ES
dc.description.abstract A causa dels efectes nocius dels insecticides químics en els ecosistemes i sobre els organismes beneficiosos, la implementació d'agents de control biològic ha rebut considerable atenció. Entre els agents de control biològic, s'ha dedicat gran interès als entomopatògens, per la seva potencial per controlar plagues agrícoles i domèstiques, vectors de malalties humanes i animals, sense introduir material no degradable en el medi ambient. Bacillus thuringiensis (Bt) és l'agent de control microbià comercial més utilitzat en l'actualitat, amb efectivitat contra diferents espècies d'insectes plaga. Les diferents soques de Bt produeixen, durant la fase d'esporulació del creixement bacterià, cristalls paràsporals composats de proteïnes, anomenades δ-endotoxines o proteïnes Cry (de cristall). A més, aquest bacteri, durant la fase de creixement vegetatiu, produeix un altre tipus de proteïnes insecticides, a saber, Cry1I, Vip i Sip. Les proteïnes Cry1I no formen part del cristall Bt, però també s’anomenen "Cry" perquè comparteixen, amb la majoria de les proteïnes de cristall, una estructura de 3 dominis. Les proteïnes insecticides Cry de Bt són altament selectives, no tòxiques per als vertebrats i ràpidament degradables. A causa d'aquestes característiques, Bt ha guanyat una gran importància en el control de plagues d'insectes agrícoles i molts estudis s'han centrat, en el passat i present, en l'aïllament i la caracterització de nous ceps que puguin conduir a trobar noves toxines amb un espectre d'activitat més ampli i major toxicitat insecticida. Objectius La importància de Bt en el control biològic de plagues, va fer que aquesta Tesi tingués els següents objectius: - Caracterització dels aïllats de Bt iranians - Expressió, aïllament i purificació de noves proteïnes insecticides com Cry1Ia - Avaluació de l'activitat insecticida i citotòxica de les toxines Cry1Ia - Estudi del pas d'oligomerització en el mode d'acció de les proteïnes Cry1Ia - Avaluació de l'activitat antimicrobiana de les soques Bt - Determinació dels efectes bioquímics de les soques Bt sobre les cèl·lules vegetals Segons aquests objectius, la tesi s'ha dividit en sis parts principals que corresponen a cadascun d'ells. Materials i mètodes Els materials i mètodes generals utilitzats en aquest treball es descriuen a continuació. Altres metodologies específiques utilitzades en cadascuna de les sis parts principals que componen aquesta tesi es descriuen després, sota el títol de cadascuna de les parts anunciades. - Soques bacterianes En aquest estudi es van utilitzar un total de 130 soques de Bt iranianes que formaven part de una col·lecció de Bt al Laboratori de Control Biològic de la Universitat de Teheran. A més, la soca HD1S2005 de B. thuringiensis HD1 (Bt HD1) (proporcionada amablement per Valent Bioscience, Inc., Libertyville, IL, EUA) i B. thuringiensis subsp. thuringiensis HD2 (Berliner) (Bt HD2, obtinguda del Bacillus Genetic Stock Center, BGSC, Ohio State University, Ohio, EUA), es va utilitzar com a soques estàndard de referència. Les soques d'Escherichia coli DHα5 i BL21 (DE3) es van utilitzar com a cèl·lules competents per a la clonació gènica i l'expressió de proteïnes. - Cria d'insectes En aquesta investigacióes van utilitzar vuit espècies diferents de lepidòpters i una plaga de coleòpters, per realitzar els bioassaigs iels assaigs de formació d'oligòmers. Entre les espècies d'insectes lepidòpters quees van utilitzar per realitzar els experiments de bioassaigs, estan Spodoptera exigua, S. littoralis, Mamestra brassicae i Helicoverpa armigera pertanyen a la família Noctuidae, Grapholitamolesta, Plodia interpunctella i Ostrinia nubilalis de les famílies de Tortricidae, Pyralidae i Crambidae, respectivament. Lobesia botrana (Tortricidae), O. nubilalis i un coleopter; Leptinotarsa decemlineata de la família Chrysomelidae, van ser seleccionats per a la obtenció i preparació de vesícules de membrana intestinal,per la realització dels assaigs de formació d'oligòmers. Totes les colònies d'insectes van ser criades en la dieta artificial i mantingudes a 25 ± 1 ° C, 70 ± 5% RH i amb un fotoperíode L: D de 16: 8. - Línies cel·lulars d'insectes Es van utilitzar quatre línies de cèl·lules d'insectes en aquest estudi: BTI-Tn-5B1-4 (Hi5), obtingudes a partir de cèl·lules ovàriquesde Trichoplusia ni, RP-HzGUTAW1 (HzGUT) obtingudes a partir de cèl·lules intestinals d'Helicoverpa zea, UCR-SE, de S. exigua i cèl·lules Sf21, obtingudes de cèl·lules dels ovaris de S. frugiperda. Les línies cel·lulars d'insectes es van cultivar en un mitjà adequat de cultiu cel·lular i es van mantenir sota les condicions recomanades pel proveïdor (Laboratori de Virologia, Universitat de Wageningen, Països Baixos). - Preparació de vesícules de membrana intestinal (BBMV) Les vesícules de membrana intestinals (BBMV) van ser purificades a partir de intestins obtinguts de larves d'últim estadi larvari d'O. nubilalis i L. decemlineatai d’insectes sencers (larves d'últim estadi larvari) de L. botrana,. Per obtindre les BBMV. es va aplicar el mètode diferencial de precipitació de magnesi (Wolfersberger et al., 1987), modificat per Escriche et al., (1995). Les BBMV purificades es va quantificar mitjançant l'assaig de Bradford i es va emmagatzemar a -80 ° C fins a l'ús. - Solubilització de protoxina i activació de la toxina Les soques de B. thuringiensis es van cultivar en un medi CCY-agar i es van incubar a 29ºC durant 2 dies. La producció i la solubilització de les proteïnes del cristall es van realitzar tal com ho va descriure Estela et al. (2004). La concentració de proteïnes va ser determinada per l'assaig de Bradford (Bradford, 1976). L'activació de protoxina es va realitzar afegint 10% de tripsina (w / w) i incubant la mostra durant 2 hores a 37 ° C. Les proteïnes activades solubilitzades i tripsines van ser analitzades mitjançant electroforesi en gel de poliacrilamida (SDS-PAGE) del 12% de dodecilsulfat sòdic tal com es descriu en Laemmli 1970. - Expressió, purificació i activació de proteïnes Cry clonades La proteïna Cry1Ab (utilitzada com a control en aquest estudi), es va obtenir a partir de la soca recombinant deE. coli GG094-208 (del Dr. R.A. de Maagd, Universitat de Wageningen, Països Baixos). La proteïna Cry1Ia7 originalment obtinguda d'una soca espanyola de Bt, HU4-2 (Martínez et al., 2004), va ser amablement proporcionada pel Dr. Primitivo Caballero (Universitat Pública de Navarra, Pamplona, Espanya). Les proteïnes Cry1Ia38, Cry1Ia38-I116V i Cry1Ia7 es van expressar a les cèl·lules E. coli, BL21 (DE3) recombinants. L'expressió de proteïna Cry1Ab, la purificació dels cossos d'inclusió, la solubilització i l'activació de protoxina mitjançant tripsina es va realitzar tal com s'ha descrit anteriorment (Sayyed et al., 2005). Per obtenir el fragment principal corresponent a la toxina activada de Cry1Ab, es va realitzar una cromatografia d'intercanvi anionic en una columna MonoQ 5/5 utilitzant el sistema explorador Äkta 100 (GE Healthcare, Regne Unit). Les fraccions eluïdes de la columna es van analitzar individualment mitjançant electroforesi SDS-PAGE. L'expressió de les proteïnes Cry1Ia38, Cry1Ia38-I116V i Cry1Ia7 en les cèl·lules recombinants E. coli, BL21 (DE3), la purificació d'afinitat mitjançant una columna bruta HisTrapTM FF (GE Healthcare Bio-Sciences, Upsala, Suècia), la diàlisi de proteïnes i l'activació de protoxina per la tripsina es va realitzar segons s’ha publicat en Khorramnejad et al., (2018). La concentració de les proteïnes Cry1Ab, Cry1Ia38, Cry1Ia38-I116V i Cry1Ia7 es va estimar mitjançant densitometria utilitzant la versió 12.3 del programa TotalLab Quant, emprant albúmina sèrica bovina (BSA) com a proteïna estàndard. Metodologia específica per objectius: Primera part: caracterització de les soques de B. thuringiensisde Iran - Aïllament de soques de Bt a partir de mostres de Iran El mètode de selecció amb acetat es va utilitzar per aïllar, inicialment, les soques Bt. Aquest mètode es basa en que l'acetat de sodi (0,25 mM) inhibeix de manera selectiva la germinació de les espores de Bt i no d'altres espores, de manera que es poden eliminar les espores germinades i tambéaltres bacteris que no formen espores, seguint un tractament tèrmic de 7 min a 80 ̊C. A continuació, les mostres es van sembrar en placa (en agar nutritiu) i es van incubar 16 hores a 29 ° C. Les colònies obtingudes es van examinar mitjançant tinció de Gram i es va observar la presència de cristalls paraesporals mitjançant microscòpia de contrast de fases. Els aïllats de Bt es van classificar com a tals després d'observar la seva capacitat de produir cristalls paraesporals. -Bioassaigs Es va realitzar una selecció preliminar de soques Bt amb capacitat insecticida enregistrant la toxicitat de les 130 soques de Bt natives contra larves de segon estadi de P. interpunctella. Els bioensayos es van realitzar amb una concentració exclusiva de 108 cèl·lules / ml (més alta que la LC50 calculada) contra les larves de P. interpunctella pel mètode d'incorporació en dieta. Els assaigs es van dur a terme utilitzant 20 larves, amb tres repeticions. L'aigua es va utilitzar com a control negatiu. La mortalitat es va registrar després de 72 hores de tractament. Basant-se en aquest cribratge, es van seleccionar set soques de Bt amb diferents activitats larvicides i es van analitzar contra larves nounades de S. exigua, G. molesta, O. nubilalis i M. Brassicae, per mètode de contaminació superficial tal com ho descriu Hernández-Martínez et al., 2008. Es van realitzar experiments amb protoxines i toxines activades, i es van repetir tres vegades, amb 48 larves en cada replicat. El tampó de solubilització i la soca HD1 es van utilitzar com a control negatiu i soca de referència, respectivament. Els bioensayos es van realitzar a 25 ± 1 ° C, 60 ± 5% RH i 16: 8 fotoperíode L / D. La mortalitat es va enregistrar després de 7 dies de tractament. - Assajos de viabilitat cel·lular La viabilitat cel·lular es va analitzar utilitzant el reactiu CellTiter 96 ® AQueous One Solution (Promega Co, Madison, WI, EUA). La técnica es basa en la detecció de la reucció de la sal de tetrazolium (MTT- 3- (4,5-Dimetil-2-tiazolil) 2,5-difenil-2H -tetrazolium bromide). L'assaig de viabilitat cel·lular es va realitzar amb quatre línies cel·lulars procedents de T. ni (Hi5), H. zea (HzGUT), S. exigua (UCR-SE) i S. frugiperda (Sf21). L'activitat citotòxica es va investigar mitjançant observació microscòpica, assaig d'una sola dosi i assaig de dosi-resposta. Es va realitzar un assaig de dosi única amb proteïnes dels cristalls solubilitzades i tripsinizades, per determinar l'activitat citotòxica de totes les soques Bt seleccionades contra les quatre línies cel·lulars d'insectes. Posteriorment, es van realitzar assaigs de dosi-resposta per a les soques més tòxiques contra les línies cel·lulars d'insectes més susceptibles. Per als assaigs d'una sola dosi, es van utilitzar 10 μl de proteïna solubilitzada (a una concentració de 1 μg / μl) o toxina activada amb tripsina (a una concentració de 7 μg / μl). Per a l'assaig de dosi-resposta, les cèl·lules es van tractar amb proteïna tripsinitzada a diferents concentracions, des de 0,64, 3,2, 16, 80 a 400 μg / ml. Els canvis morfològics induïts per toxines es van registrar després de l'observació amb un microscopi invertit (Leica DMI 3000B), en els intervals temporals d'1, 3, 6 i 16 hores després de l'exposició a la toxina. La viabilitat cel·lular es va mesurar 16 hores després del tractament de les cèl·lules en assaigs de dosi única, i 6 hores després de l'exposició, en assaigs de dosi-resposta. Tots els experiments es van realitzar per duplicat i es van repetir dues vegades. - Perfil de proteïna i anàlisi proteòmic Per tal d’obtindre el perfil proteic, les proteïnes solubilitzades i també les tripsinizades van ser analitzades mitjançant electroforesi en gel de poliacrilamida 12% (SDS-PAGE) tal com va descriure Laemmli 1970. Les proteïnes de cristall insecticida produïdes per cadascuna de les soques Bt van ser analitzades per cromatografia líquida i l'espectrometria de masses tàndem LC-MS / MS. Aquestes tècniques es van realitzar al Servei de Proteòmica del SCSIE-Servei Central de Suport a la Investigació Experimental, a la Universitat de València, València, Espanya.. - Identificació de contingut genètic L'ADN total de les soques Bt seleccionades va ser extret i purificat segons Ferrandis et al. (1999). Les soques de Bt es van caracteritzar utilitzant 27 parells de primers, be dissenyats en aquest treball o be descrits anteriorment a la bibliografia. Els productes de PCR es van analitzar amb gel d'electroforesi en agarosa, al 1%. L'ADN amplificat es va purificar utilitzant kit NucleoSpin Gel i PCR Clean-up (MACHEREY-NAGEL, Alemanya) i va ser enviat a Stab Vida (Investigação e Servicis em Ciências Biologicas Lda, Portugal) per a la seqüenciació. Les seqüències van ser editades i analitzades utilitzant el programa Geneious (versió 10.0.9). Els analisi de les seqüències d'ADN es van realitzar mitjançant la base de dades del NCBI. - Producció d'Β-exotoxina La possible presència d'β-exotoxina a les soques Bt també va ser determinada per LC-MS / MS. La preparació de la mostra es va fer tal com ho descrivia Hernández et al. 2003. Segona part: Aïllament, clonació, expressió, i purificació de noves proteïnes insecticides La soca de Bt IE-1, aïllada de les larves infectades d'Ephestia kuehniela, es va caracteritzar en profunditat, analitzant el seu contingut genètic i la seva composició de proteïnes insecticides. La investigació va conduir al descobriment d’un nou gen cry1Ia en la soca IE-1. Va ser nomenat cry1Ia38 (Gene Bank Acc. Número MG584186). - Clonació del gen cry1Ia38 El gen complet cry1Ia38 es va clonar a partir de l'ADN genòmic extret de la soca IE-1. Els encebadors utilitzats per a l'amplificació del gen per PCR van ser el Ia38-F (5'GGATCCATGAAACTAAAGAATCAAGAT 3 ') i el Ia38-R (5'GTCGACCTACATGTTACGTTACGCTCAATC 3'). Després de l'amplificació, els productes de PCR es van clonar en el vector de clonació pGEM-Teasy. Posteriorment, el gen cry1Ia38 clonat es va subclonar en el vector d'expressió, PET-30a (+). La construcció resultant es va transformar en cèl·lules E. coli DHα5. La seqüència inserida es va confirmar mitjançant seqüenciació amb iniciadors d'inserció, en ambdues direccions. Després de la seqüenciació, els transformants reeixits es van transformar en cèl·lules E. coli BL21 (DE3) per a la seva expressió. La proteïna Cry1Ia38 produïda es va purificar per cromatografia d'afinitat (veure "Expressió, purificació i activació de proteïnes Cry clonades"). - Mutagènesi dirigida pel lloc. La substitució de Ile116 per Val en la posició 116 es va realitzar mitjançant PCR de solapament-extensió, usant el gen cry1Ia38 clonat en PET-30a (+) com a motlle. La seqüenciació de l'ADN va verificar la mutació puntual. Tercera part: Investigació de les propietats insecticides i citotòxiques de les toxines Cry1Ia La caracterització molecular, activitats insecticides i citotòxiques de la protoxina Cry1Ia38 i de la proteïna activada, es van estudiar amb larves nounades d'O nubilalis, G. molesta, H. armigera, S. exigua i S. ittoralis, pel mètode de contaminació en superfície, a una concentració única de 1000 ng / cm2. A més, les activitats citotòxiques de la protoxina Cry1Ia38 i de la toxina activada es van determinar contra la línia cel·lular Sf21, usant quatre concentracions diferents (0,16, 0,8, 4 i 20 mg / ml). L'activitat insecticida de la Cry1Ia38-I116V (protoxina i toxina activada) es va avaluar contra nounats d'O nubilalis, S. exigua, G. molesta i S. littoralis a 1000 ng / cm2, com s'ha descrit anteriorment. Les activitats citotòxiques també es van determinar contra la línia cel·lular Sf21, a les quatre concentracions usades per Cry1Ia38. Per comparar les activitats insecticides amb altres proteïnes Cry1Ia, es va escollir la toxina Cry1Ia7, prèviament analitzada i clonada, i disponible al Laboratori de Control Biotecnològic de Plagues (Departament de Genètica, Universitat de València), on s'ha realitzat aquesta tesi. La seqüència d'aminoàcids de Cry1Ia38 va ser 96% idèntica a la de Cry1Ia7. L'activitat insecticida es va avaluar amb larves de primer estadi d'O nubilalis, G. molesta, M. brassicae i S. littoralis, a 1000 ng / cm2 similarment a Cry1Ia38. L'activitat citotòxica a quatre concentracions diferents (0.16, 0.8, 4 i 20 mg / ml) també va ser avaluada contra dues línies cel·lulars d'insectes, la Sf21 i la Hi5. Quarta part: Estudi del pas d'oligomerització en el mode d'acció de les proteïnes Cry1Ia - Marcatge amb biotina de la proteïna Cry1Ia La proteïna Cry1Ia activada amb tripsina va ser biotinilada utilitzant el kit de biotinilació de proteïnes de GE Healthcare (GE Healthcare, Little Chalfont, Regne Unit) segons les instruccions del fabricant, tal com es descriu en la bibliografia (Hernández-Martínez et al., 2014). - Assajos d'oligomerització amb cèl·lules Sf21 Els assajos d'oligomerització es van realitzar segons el metode de Portugal et al (2014) amb lleugeres modificacions. En resum, 100 ml de suspensió cel·lular (2x106 cèl·lules / ml) es va tractar amb toxines activades (Cry1Ia biotinilada i Cry1Ab) a una concentració final de 0,03 mg proteïna / ml. Les plaques es van incubar durant 3 hores a 25 ° C. Posteriorment, les cèl·lules es van recollir per centrifugació a 16.200 × g, 4 ° C durant 15 minuts, es van rentar amb 200 ml de tampó de carbonat 50 mM pH 10.5 i es van recuperar després de centrifugació durant 45 min a 18.800 × g. Les cèl·lules es van re-suspendre en 10 ml de tampó i es van escalfar a 50 ºC, 3 minuts. Les proteïnes presents a la mostra es van separar per SDS-PAGE al 10% i es van electrotransferir a una membrana de difluoruro de polivinilideno (PVDF). La membrana es va bloquejar o / n en PBS amb Tween 20 al 0,1% (PBST) complementat amb llet desnatada al 5%, amb agitació suau. Després de tres rentats amb PBST, la membrana es va incubar amb anticossos: (1) Cry1Ab es va detectar amb anticòs policlonal anti-Bt Cry1Ab / 1Ac de conill (Abraxis Warminster, Pennsylvania, Estats Units) (1: 10.000, 60 min), seguit d'anticòs secundari ( 1: 20,000; 60 min) acoblat amb peroxidasa de rave picant (HRP), i (2) la proteïna Cry1Ia biotinilada va ser detectada amb HRP conjugada amb estreptavidina (1: 2.000; 60 min). Les dues proteïnes Cry1Ab i Cry1Ia es van visualitzar per quimioluminescència utilitzant el reactiu ECLTM (GE Healthcare) i l'analitzador d'imatges ImageQuant LAS400. Cada assaig d'oligomerització es va repetir almenys tres vegades. - Assajos d'Oligomerització amb BBMV Els assajos es van realitzar seguint el protocol d’Ocelotl et al (2015) amb algunes modificacions: 2 mg de Cry1Ia marcada amb biotina o Cry1Ab activada es van incubar, durant una hora amb 5 mg de BBMV de L. botrana o L. decemlineata, o amb 20 mg de BBMV d'O nubilalis, a 37 ° C, en un volum final de 50 ml. Proteïnes activades incubades en absència de BBMV i mostres que contenien només BBMV, es van usar com a controls. La resta de l'experiment es va dur a terme com s'ha exposat en la secció anterior. Els assajos es van repetir, almenys, tres vegades. Cinquena part: Avaluació de l'activitat antimicrobiana de les soques de Bt seleccionades L'efecte inhibitori es va avaluar contra els fongs fitopatògens, F. oxysporum subsp. lycopersici i bacteri Erwinia sp. Inicialment, la presència de gens d'endo i exo-quitinasa es va estudiar mitjançant l'amplificació dels gens respectius per PCR, utilitzant dos parells de primers específics. L'activitat antibacteriana de les set soques de Bt seleccionades contra Erwinia sp. es va provar utilitzant el mètode de difusió tal com ho descriu Djenane et al., (2017). L'activitat antifúngica de les soques Bt contra F. oxysporum subsp. lycopersici es va estudiar utilitzant el mètode de cultiu dual (Knaak et al., 2007). Sisena part: Determinació dels canvis bioquímics i fisiològics provocats per les soques Bt, sobre cèl·lules vegetals - Manteniment de les plantes de tomàquet i inoculació bacteriana Plantes de tomàquet, Solanum lycopersicum L., (conrear Falat), es van desenvolupar i van mantenir en condicions controlades (25 ± 5 ° C, 16: 8 hores (L / O), 65 ± 5% RH) en hivernacles, en sòl estèril autoclavat. Plàntules de tomàquet de dues setmanes es van transferir a testos (dues plantes per test) i es van regar diàriament amb aigua. Les plantes de sis setmanes es van dividir en quatre grups: (1). Inoculació de la rizosfera, (2). Controls que van rebre aigua destil·lada estèril en la rizosfera, (3). Inoculació de filoplano i (4). Controls del filoplano, que va ser ruixat amb aigua destil·lada estèril. En dos tractaments, les plantes es van polvoritzar o inocular amb barreges d'espores i cristalls de la soca AzLp. La inoculació de la rizosfera es va fer amb pipetes, afegint 5 ml d'una suspensió de 108 espores / ml prop de les arrels. En el tractament de polvorització, el sòl es va cobrir amb plàstic per evitar la transferència de la suspensió de Bt a terra, i es va realitzar amb una suspensió de 108 espores / ml, fins a la escorrentia. Es van usar 28 testos de tomàquet en cada tractament, 96 testos en total. Després de 0 (2 hores després de l'aplicació de Bt com 0 dies), 1, 2, 3, 5, 7, 10 i 15 dies després del tractament, es van recollir les fulles madures, es van moldre en nitrogen líquid i es van mantenir a - 80 ° C fins al seu ús. - Respostes bioquímiques i fisiològiques a les plantes de tomàquet Es van determinar i comparar les activitats enzimàtiques (catalasa, superóxido dismutasa, ascorbato peroxidasa, fenilalanina ammonia-liasa i polifenol oxidasa) i paràmetres no enzimàtics (proteïnes, hidrats de carboni, fenilalanina i fenòlics) en fulles tractades i no tractades. Per mesurar l'activitat enzimàtica, 0,5 g de la mostra de la fulla es va homogeneïtzar en un ml de tampó fosfat 50 mM pH 6,8 seguit de centrifugació a 13000 × g durant 15 min a 4 ° C. El sobrenedant obtingut es va utilitzar com extracte enzimàtic i es va utilitzar per a la determinació de la catalasa (Aebi 1984), superóxido dismutasa (Beauchaup i Fridovich, 1971), ascorbato peroxidasa (Ranieri et al., 2003) i polifenol oxidasa (Kar i Mishra, 1976). L'activitat de la fenilalanina ammonia-liasa es va mesurar seguint el protocol descrit per Wang et al., (2006). El contingut de la prolina en les mostres de la fulla es va determinar utilitzant ninhidrina àcida (Carillo i Gibon, 2011). L'estimació del contingut fenòlic total es va realitzar mitjançant el reactiu Folin-Ciocalteu (Ainsworth i Gillespie, 2007). El contingut de proteïnes i el carbohidrat soluble total en fulles de tomàquet es van mesurar tal com es va descriure en Bradford (1976) i en Dreywood, (1946) respectivament. Resultats i discussió Primera part: caracterització de soques de B. thuringiensis En aquest estudi es van utilitzar 130 soques de Bt: 88 procedents d'una col·lecció de Bt del Laboratori de Control Biològic de la Universitat de Teheran, i 42 aïllades de mostres de sòl i larves d'insectes infectats recollits de localitzacions ambientalment diverses a l'Iran. Es van realitzar proves preliminars de selecció amb barreges d'espores i cristalls usant larves de segon estadi de P. intenpunctella. En base a aquests resultats, les 130 soques de Bt es van classificar en funció de la seva toxicitat en tres grups de virulència: alt, mitjà i baix. Cinc soques de Bt aïllades de larves infectades (IE-1, AzLp, IE-2, IP- 2 e IEP), així com altres dues soques de Bt aïllades del sòl (DCF i MCH), es van classificar en la primera categoria, causant una mortalitat de més del 67%. La majoria de les soques (119 soques de Bt) no van causar mortalitat significativa (menys del 34%) i només quatre soques van mostrar activitat moderada (34% a 67% de mortalitat). A partir d'aquests resultats, set soques de Bt amb diversa activitat larvicida (IE-1, AzLp, IE-2, IP-2 i IEP, altament tòxiques i les soques KHF i RM Bt que van mostrar activitat respectivament baixa i no tòxica) van ser seleccionades i caracteritzades amb més detall en aquest treball. L'espectre d'activitat tòxica es va avaluar mitjançant bioassajos usant el mètode de contaminació de la dieta en superficie, utilitzant larves de primer estadi dels lepidòpters S. exigua, M. brassicae, G. molesta i O. nubilalis (que representen les famílies Noctuidae, Tortricidae, Crambidae i Pyralidae d'ordre Lepidoptera) a una concentració de 1000 ng / cm2. G. molesta i O. nubilalis, van ser els insectes més susceptibles tant a les protoxines com a les toxines activades. Diversos graus de mortalitat es van observar quan es van usar larves de S. exigua i M. brassicae. Entre ells, les protoxines i les toxines activades de AzLp, IE-2 i IP-2 van exhibir els nivells més alts de toxicitat per a aquests dos insectes en comparació amb les de l'estàndard Bt HD-1. Per completar l'anàlisi toxicitat, es van realitzar assajos in vitro amb línies cel·lulars de lepidòpters (activitat citotòxica) de la família Noctuidae. Les proteïnes cristal·lines de AzLp, IE-2 i IP-2 van ser les més tòxiques per a totes les línies cel·lulars, especialment per Sf21. Els assajos in vitro van indicar que les soques IE-1 i RM van ser poc tòxiques per a totes les línies cel·lulars analitzades, similarment a la soca de referència HD-1. A més, després d'exposar les cèl·lules Sf21 a diferents concentracions de toxines activades de AzLp IE-2 i IP-2, es van observar canvis morfològics, com inflat osmòtic o cèl·lules amb forma de globus. El resultat dels assajos va mostrar que en augmentar la concentració de toxina, la viabilitat de les cèl·lules disminuïa. Les soques IE-2 i IP-2 van exhibir una activitat citotòxica estadísticament similar, amb EC50 de 1,03 i 1,60 mg / ml, respectivament. Els nostres resultats van mostrar que les soques de Bt seleccionades presentaven perfils proteics similars en SDS-PAGE, compostos per proteïnes amb pesos moleculars entre 130 i 20 kDa. Els perfils de bandes van ser, generalment, similars al de Bt HD-1 i van consistir principalment en dues bandes de aprox. 130 (que podrien correspondre a proteïnes de tipus Cry1) i sobre 65 kDa (probablement corresponent a proteïnes de tipus Cry2 o Cry1 processada). Després de la solubilització, les proteïnes activades amb tripsina van mostrar perfils de bandes en pràcticament idèntics, evidenciant dues bandes majoritàries d'al voltant de 65 kDa. L'anàlisi proteòmic per LC-MS / MS va mostrar que les proteïnes Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ca, Cry1Da i Cry2Aa eren les més abundants als cristalls de les soques Bt seleccionades. Les proteïnes de la família Cry1A van ser les més abundants segons els valors quantitatius. Cry1Ac va ser l'única proteïna assignada la soca RM. Per a la soca KHF, no es va identificar cap proteïna similar a les proteïnes cristal·lines insecticides de Bt conegudes fins ara. L'anàlisi de PCR es va dur a terme per identificar els gens codificants per proteïnes Bt, tant les secretades durant l'etapa vegetativa de Bt (gens cry1I, vip i sip) com les presents en els cristalls (gens cry, CYT i ps). Es va observar que el gen cry2 estava present en totes les soques provades. Excloent KHF, les altres soques van produir els amplicons esperats en base als resultats de proteòmica obtinguts anteriorment. Les soques IE-1, AzLp, IE-2, IP-2 i IEP van mostrar amplificació per PCR positiva per als gens cry1Ac, cry1I, vip3. En cap de les soques es van amplificar els gens cry1Ad, cry1Ag, cyt1, cyt2, vip1, vip2, sip1, ps1, ps2, ps3 o PS4. Com a pas final de la caracterització, es va investigar la producció de β-exotoxina, requisit necessari per a proposar una nova soca de Bt com a candidat per a ús comercial. La β-exotoxina és tòxica per a vertebrats, de manera que els bioinsecticides basats en Bt que la produeixen estan prohibits. La presència de β-exotoxina es va determinar per LC-MS / MS en el sobrenedant del cultiu de Bt en fase vegetativa. Els resultats van mostrar la seva absència en totes les soques Bt seleccionades, classificant com a aptes per a futurs bioplaguicides. En resum, d'un total de 130 soques iranianes de Bt, 7 van ser seleccionades per ser extensivament caracteritzades emprant diferents metodologies. Com a resultat, a causa de l'alta toxicitat per a diferents larves i línies cel·lulars d'insectes, la presència de proteïnes insecticides i l'absència de β-exotoxina, les soques AzLp, IE-2 i IP-2 es poden proposar com a candidates per al desenvolupament de nous bioinsecticides basats en Bt. Segona Part: Aïllament, clonació, expressió i purificació de noves proteïnes insecticides A causa de l'extensa aplicació de productes basats en Bt, en alguns insectes plaga s'han detectat brots de resistència. S'han emprat diverses estratègies per millorar l'eficàcia dels insecticides basats en Bt i el descobriment de noves soques és necessari per descobrir noves toxines amb diferents modes d'acció i potser un rang més ampli d'activitat insecticida. En aquesta Tesi, en la recerca de nous gens cry que codifiquin noves toxines, a la soca IE-1, es va trobar un nou gen tipus cry1Ia. Va ser anomenat cry1Ia38 (Gene Bank Acc. Number MG584186), i es va observar que tenia 2160 pb, que codificaven una proteïna de 719 aminoàcids. Aquest gen es va clonar a partir de l'ADN genòmic extret de la soca IE-1 i es va expressar en cèl·lules d'E coli BL21. El gen va codificar per una proteïna de 80 kDa, massa molecular única entre les proteïnes cristal·lines de 3dominis, i comú a totes les toxines Cry1I. L'activació va donar com a resultat un pèptid estable d'aprox. 50 kDa (toxina activada). Posteriorment es va comparar la toxicitat de Cry1Ia38 amb la d'un mutant puntual d'aquesta generat mitjançant mutagènesi dirigida, el Cry1Ia38-I116V, que té substituïda Ile per Val en la posició 116, en el domini I de la proteïna. L'expressió de Cry1Ia38-I116V va resultar en una protoxina de 80 kDa, que després d’activar es va mostrar com una banda de 50 kDa en SDS-PAGE. Tercera part: Avaluació de les propietats insecticides i citotòxiques de les toxines Cry1Ia Els bioassaigs van mostrar que la protoxina Cry1Ia38 era altament tòxica per O. nubilalis i G. molesta, poc tòxica per a S. exigua i S. littoralis, i innòcua per H. armigera. La proteïna Cry1Ia38 activada, va resultar altament tòxica per G. molesta i moderadament tòxica O. nubilalis. En base als assaigs de viabilitat cel·lular, Cry1Ia38 (protoxina o toxina) no va ser tòxica per a les cèl·lules Sf21 a les concentracions provades. L'activitat insecticida de la protoxina i la proteïna tripsinizada de Cry1Ia38-I116V, es va deterninar amb de larves d'O nubilalis, G. molesta i S. exigua i S. littoralis a una concentració de 1000 ng / cm2. La protoxina va resultar tòxica per O. nubilalis i G. molesta, mentre que el mutant activat amb tripsina va perdre la toxicitat contra tots dos insectes. Per tant, les dades indiquen que la mutació va afectar l'activitat insecticida. De manera similar al que s'havia trobat amb Cry1Ia38, la protoxina i la toxina activada de Cry1Ia38-I116V no van resultar tòxiques per a les cèl·lules Sf21. La caracterització molecular i les activitats insecticides i citotòxiques de Cry1Ia7 es van analitzar i van comparar amb les proteïnes obtingudes en el present treball, Cry1Ia38 i Cry1Ia38-I116V. Els nostres resultats van mostrar que la protoxina de Cry1Ia7 era tòxica per O. nubilalis i G. molesta. Però la toxina activada va donar una toxicitat menor que la d'Cry1Ia38 per G. molesta. L'assaig de viabilitat cel·lular va mostrar que Cry1Ia7 no era tòxica per a les cèl·lules Sf21 o Hi5 a les concentracions provades (no es van observar diferències estadísticament significatives entre elles). Només després de 48 hores d'exposició a la concentració més alta de la Cry1Ia7 activada (20 mg / ml), es va observar una pèrdua del 40% de la viabilitat cel·lular en les dues línies cel·lulars. En resum, en aquesta investigació es va avaluar i va comparar l'espectre insecticida de diferents proteïnes Cry1Ia. D'acord amb els nostres troballes, les protoxines de Cry1Ia38 i Cry1Ia7 van ser tòxiques per a les larves d'O nubilalis i G. molesta. Però la Cry1Ia7 activada amb tripsina no va mostrar activitat insecticida contra les larves de G. molesta, mentre que Cry1Ia38 sí que ho va fer. En conjunt, tot i que hi ha una alta identitat entre les seqüències d'aminoàcids de les proteïnes Cry1Ia provades, es van detectar diferències significatives en l'activitat insecticida de les formes activades per tripsina d'aquestes toxines, en particular, contra G. molesta. Quarta part: Estudi de la oligomerització en la manera d'acció de les proteïnes Cry1Ia El mode d'acció de les toxines Cry de Bt comença per la ingestió de les inclusions cristal·lines paraesporals i la seva solubilització (per les condicions de pH de l'intestí mitjà de l'insecte), convertint-les en protoxines. Aquestes són activades per les proteases de l'intestí mitjà de l'hoste, produint nuclis resistents a proteases o toxines. El mode d'acció de les proteïnes Cry de 3-dominis que composen el cristall paraesporal de Bt, no està totalment dilucidat. D'acord amb el model d'unió seqüencial, després d'aquesta activació proteolítica, a l'intestí els monòmers s'uneixen a receptors de membrana tipus cadherina. Aquesta unió desencadena un últim tall proteolític que afavoreix la oligomerització de toxines, i després d'això, la seva inserció en les membranes intestinals i la formació de porus. La formació d'un oligómer abans de la inserció en membrana s'ha descrit com un pas important i necessari per al procés de toxicitat. A causa de les característiques específiques de les proteïnes Cry1I (les quals tenen 3 dominis però no formen cristall), una millor comprensió del seu mode d'acció és fonamental per millorar la seva eficàcia enfront de les plagues d'insectes. En aquest estudi, s'ha determinat per primera vegada la formació d'oligòmers de Cry1Ia i la possible relació entre aquests i la activitat insecticida d’aquesta proteïna. Atès que les proteïnes Cry1I tenen activitat doble contra les plagues de lepidòpters i coleòpters, es va estudiar la formació d'oligòmers d'Cry1Ia7 després d'incubar la proteïna amb BBMV del coleòpter susceptible L. decemlineata, del lepidòpter susceptible L. botrana, i del lepidòpter no susceptible O. nubilalis. A més, en aquest estudi es va emprar la línia cel·lular Sf21 com a model derivat de cèl·lules. També es va seleccionar Cry1Ab com a proteïna control, per que la seva oligomerització ha estat demostrada en diversos estudis. Els nostres resultats van mostrar clarament que Cry1Ab pot oligomerizar en la forma d'tetràmer proposada per altres autors (mida de pes molecular de 250 kDa) després d'entrar en contacte amb BBMV o cèl·lules d'insectes independentment de la susceptibilitat de l'hoste, ja que es van observar oligòmers després de la incubació de la proteïna tripsinizada amb BBMV d'O nubilalis o L. botrana (insectes susceptibles), però també amb BBMV de L. decemlineata (no susceptible) i cèl·lules Sf21 (cèl·lules no susceptibles). Però la toxina Cry1Ia va formar oligòmers només després de la incubació amb BBMV de L. decemlineata (coleòpter susceptible) però no després de la incubació amb BBMV de lepidòpters o cèl·lules, independentment de la seva susceptibilitat. Basant-se els nostres resultats, el model d'unió seqüencial del mode d'acció de les toxines de Bt de tres dominis, que inclou la oligomerització, pot no ser general per a tots els membres de la família Cry de tres dominis. Aquestes dades indiquen que possiblement Cry1Ia tingui un mode d'acció diferent a altres proteïnes Cry, afavorint que puguin usar-se en combinació amb aquestes últimes en insecticides o plantes transgèniques, per retardar l'evolució de la resistència en els insectes diana. Cinquena part: Avaluació de l'activitat antimicrobiana de les soques Bt Fins ara, només les propietats insecticides de Bt atreien atenció. No obstant això, en els últims anys, s'han descobert altres accions de Bt en el control de malalties de les plantes, ja que hi ha evidències d'una acció antibiòtica d'espores i cristalls de soques de Bt sobre fongs i bacteris fitopatògens. Trobar una formulació basada en Bt específica, fàcilment degradable i de baix cost per controlar tant les plagues d'insectes com les malalties de les plantes, seria altament valuosa en el control biològic. En aquesta Tesi, es va avaluar l'activitat antimicrobiana de les 7 soques de Bt prèviament seleccionades, contra patògens de plantes com ara el fong F. oxysporum o el bacteri Erwinia sp. A més, es va estudiar el gen de quitinasa com un important agent antifúngic en les soques de Bt estudiades. Els nostres resultats van mostrar que les soques IE-1, AzLp, IE-2, IP-2 i IEP posseeixen exoquitinasa. El gen de l'endo-quitinasa es va detectar en les soques AzLp, IE-2 i IP-2. L'activitat antifúngica de les set soques Bt es va avaluar pel mètode de cultiu dual davant de F. oxysporum subsp. lycopersici que causa podridura de l'arrel en plantes de tomàquet. El fitopatógen va créixer en la superfície de plaques d'Agar de Dextrosa de Patata i les barreres bacterianes de Bt no van inhibir el seu creixement. Com a resultat, es va concloure que la barreja d'espores i cristalls de les soques de Bt seleccionades no posseïen activitats antifúngiques. No es va observar correlació entre la presència de gens de quitinasa i l'activitat antifúngica, el que podria explicar-se per una baixa transcripció del gen o per seqüències no transcrites. L'activitat antibacteriana de les soques de Bt seleccionades es va provar pel mètode de difusió en agar, davant el bacteri patogen Gram negativa, Erwinia sp, que causa la malaltia de podridura tova del tomàquet. El bacteri fitopatógen va créixer en tota la superfície de la placa d'Agar Nutritiu i no es van observar zones clares al voltant de les colònies de Bt, el que indica que aquestes soques no van poder controlar Erwinia sp. L'activitat antimicrobiana descrita en altres soques de Bt podria ser una conseqüència de l'adaptació d'aquestes soques al seu hàbitat. Per tant, a causa de que la majoria de les soques de Bt estudiades (IE-1, AzLp, IE-2, IP-2 i IEP) havien estat aïllades de larves d'insectes infectats o morts, el més probable és que no mostressin cap activitat antimicrobiana contra els agents fitopatògens utilitzats en aquest estudi, usualment presents en el sòl (F. oxysporum subsp lycopersici i Erwinia sp). Sisena part: Determinació dels canvis bioquímics i fisiològics provocats per Bt en les cèl·lules vegetals S'ha descrit que soques de Bt tenen potencial per promoure el creixement de les plantes, millorar l'absorció de nutrients i protegir-les en condicions d'estrès abiòtic i biòtic. Bt pot protegir les plantes a través de la producció de siderófors, activitat quitinasa, augmentant les activitats dels enzims de resistència de les plantes i induint la resistència sistèmica. Tot i que els pesticides basats en Bt s'han fet servir àmpliament durant anys, se sap molt poc sobre la interacció entre les cèl·lules vegetals i Bt. L'objectiu d'aquesta part de la tesi va ser estudiar la interacció planta-Bt a nivell cel·lular, centrant-nos en l'efecte de la inoculació de Bt sobre l'estat antioxidant de la planta. Quan les plantes se sotmeten a estrès biòtic o abiòtic, hi ha una producció d'espècies reactives d'oxigen que danyen les seves cèl·lules. Per tant, enzims antioxidants com ara catalasa, superòxid dismutasa, fenilalanina amoníac-liasa i ascorbat peroxidasa són necessàries per eliminar aquestes espècies reactives i restaurar les condicions normals a nivell cel·lular. Quan les plantes pateixen estrès biòtic (com invasió de patògens), es produeixen les reaccions oxidatives (superòxid, peròxid d'hidrogen i radicals hidroxil) que desencadenen la defensa de la planta en dues fases: la fase un és inespecífica i passa immediatament després del reconeixement del patogen, però la fase dues es perllonga i condueix a la resistència a la malaltia. En aquest treball de Tesi, es va estudiar l'activitat dels enzims antioxidants després de tractar plantes de tomàquet (ruixant el filoplano o inoculant la rizosfera) amb les 7 soques de Bt seleccionades. El resultat va ser un augment significatiu d'aquestes activitats, molt probablement per reduir l'estrès oxidatiu. En el cas de tractar (en filoplano o rizosfera) les plantes de tomàquet amb una barreja d'espores i cristalls de la soca AzLp, es van observar aquestes dues fases. El tractament de plantes de tomàquet amb suspensió de Bt (barreja d'espores i cristalls) tant en filoplano com a rizosfera, va millorar significativament l'acumulació de proteïnes, carbohidrats, prolina i contingut fenòlic en fulls de tomàquet en comparació amb el tractament no inoculat. Els components no enzimàtics, com la prolina, actuen com una defensa principal contra les espècies reactives d'oxigen. Per tant, en augmentar els continguts fenòlics, de carbohidrats, proteïnes i prolina en els fulls de tomàquet, es disminueix el dany oxidatiu. En conjunt, d'acord amb les nostres observacions, l'impacte de la suspensió de Bt en les cèl·lules de tomàquet va conduir a respostes fisiològiques i bioquímiques que van augmentar l'activitat dels enzims antioxidants i la resistència induïda a l'estrès biòtic. En resum, la nostra investigació ha caracteritzat extensivament alguns aïllats de Bt iranians seleccionats segons la seva toxicitat a P. interpunctella, mitjançant l'ús de diferents tècniques complementàries. La caracterització es va realitzar sobre la base del perfil electroforètic de proteïnes, contingut de gens, anàlisi proteòmic, perfil insecticida i citotòxic i producció de β-exotoxina. Aquesta caracterització integral ha revelat tres soques Bt molt potents per controlar plagues de lepidòpters. Seguint els objectius d'aquesta tesi, l'efecte de les proteïnes de les soques de Bt seleccionades es va avaluar usant cèl·lules animals (línies cel·lulars d'insectes), cèl·lules microbianes (cultius d'Erwinia sp. i Fusarium) i cèl·lules vegetals (plantes de tomàquet). Per trobar noves activitats insecticides, es van explorar les soques seleccionades a la recerca de nous gens cry. Com a resultat, es va descobrir el gen cry1Ia38, i tant aquest com un mutant puntual d'aquest, es van clonar i expressar. Les activitats insecticides i citotòxiques de les proteïnes Cry1I es van avaluar enfront de diferents espècies de lepidòpters i línies cel·lulars d'insectes. Els resultats dels nostres bioassaigs van mostrar que Cry1Ia38 en forma de protoxina o de toxina activada, té un gran potencial per controlar O. nubilalis i G. molesta. Finalment, es van realitzar estudis de biologia molecular per estudiar la oligomerització de la proteïna Cry1Ia. Els nostres troballes van mostrar que la oligomerització no és un pas necessari en la toxicitat d'aquestes proteïnes. es_ES
dc.format.extent 618 p. es_ES
dc.language.iso en es_ES
dc.subject Bacillus thuringiensis es_ES
dc.subject insect cell line es_ES
dc.subject LC-MS/MS es_ES
dc.subject Cry1Ia proteins es_ES
dc.subject oligomer formation es_ES
dc.subject anti-microbial activity es_ES
dc.subject plant biochemical response es_ES
dc.subject PCR screening es_ES
dc.title Structural and functional diversity of Bacillus thuringiensis toxins on animal, plant and microbial cells es_ES
dc.type info:eu-repo/semantics/doctoralThesis es_ES
dc.subject.unesco UNESCO::CIENCIAS DE LA VIDA es_ES
dc.subject.unesco UNESCO::CIENCIAS AGRARIAS es_ES
dc.description.abstractenglish Due to deleterious effects of chemical insecticides on ecosystem and non-target organisms, implementation of biological control agents has received considerable attention. Amongst biological control agents, remarkable interest has been devoted to entomopathogens, because of their potential for controlling agricultural and household pests, vectors of human and animal diseases without introducing non-degradable material into environment. Bacillus thuringiensis (Bt) is the most commercially used microbial control agent with effectiveness against different insect pest species. Different Bt strains produce proteinaceous parasporal crystals during the sporulation phase of bacterial growth, called δ-endotoxin or Cry (from crystal) proteins. Moreover, this bacterium, during the vegetative growth phase, produces other type of insecticidal proteins, namely Cry1I, Vip and Sip. The Cry1I proteins do not form part of the Bt crystal but are also named “Cry” because they share, with the majority of crystal proteins, a 3-domains structure. The Bt Cry insecticidal proteins are highly selective, non-toxic to vertebrates and rapidly degradable. Hence, due to these characteristics, Bt has gained a great importance in agricultural insect pests control and many studies have focused on the isolation and characterization of novel Bt strains that may lead to finding new toxins with broader spectrum of activity and greater insecticidal toxicity. Specific objectives: Due to importance of Bt in microbial control of pests, this thesis was aimed to investigate the following objectives: - Characterization of Iranian Bt isolates - Expression, isolation and purification of new insecticidal proteins such as Cry1Ia - Assessment of insecticidal and cytocidal activity of Cry1Ia toxins - Study of the oligomerization step in mode of action Cry1Ia proteins - Evaluation of the antimicrobial activity of Bt strains - Determination of the biochemical effects of Bt strains on plant cells According to these objectives, the thesis has been divided into six main parts that correspond to each one of them.   Materials and methods The general Materials and Methods used in this work, are described below. Other specific methodologies used in each one of the six main parts that compose this thesis, are described after, under the title of each one of the announced parts. - Bacterial strains A total number of 130 Iranian Bt strains form Bt stock of Biological Control Laboratory in the University of Tehran, were used in this study. Moreover, the B. thuringiensis HD1 strain HD1S2005 (Bt HD1) (kindly provided by Valent Bioscience, Inc., Libertyville, IL, USA) and the B. thuringiensis subsp. thuringiensis strain HD2 (Berliner) (Bt HD2) (obtained from the Bacillus Genetic Stock Center, BGSC, Ohio State University, Ohio, USA), were used as reference standard strains. Escherichia coli DHα5 and BL21 (DE3) strains were employed as competent cells for gene cloning and protein expression. - Insect rearing Eight different lepidopteran species and one coleopteran pest were used in this research for performing the bioassays experiments and oligomer formation assays. Amongst the lepidopteran insect species, Spodoptera exigua, S. littoralis, Mamestra brassicae and Helicoverpa armigera belong to Noctuidae family, Grapholita molesa, Plodia interpunctella and Ostrinia nubilalis of the families of Tortricidae, Pyralidae and Crambidae, respectively, were used to perform the bioassay experiments. While Lobesia botrana (Tortricidae), O. nubilalis and one coleopteran host; Leptinotarsa decemlineata of the family Chrysomelidae, were selected for preparation of brush border membrane vesicles and performing oligomer formation assays. All the insect colonies reared on the artificial diet and kept at 25 ± 1 °C, 70 ± 5% RH and with a 16:8 L:D photoperiod. - Insect cell lines Four insect cell lines were used in this study: BTI-Tn-5B1-4 (Hi5) from ovarian cells of cabbage looper, Trichoplusia ni, RP-HzGUTAW1 (HzGUT) from gut cells of Helicoverpa zea , UCR-SE from beet armyworm, S. exigua and Sf21 cells from ovaries of the fall armyworm, S. frugiperda. Insect cell lines were grown in appropriate cell culture medium and maintained under the conditions recommended by the supplier (Laboratory of Virology, Wageningen University, The Netherlands). - Brush border membrane vesicles (BBMV) preparation Brush border membrane vesicles (BBMV) were purified from dissected midguts of last instar larvae of O. nubilalis and L. decemlineata and whole insect (last instar larvae) of L. botrana, by the differential magnesium precipitation method (Wolfersberger et al., 1987), as modified by Escriche et al., (1995). Purified BBMV were quantified by Bradford protein assay and stored at -80°C until use. - Protoxin solubilisation and toxin activation B. thuringiensis strains were grown on CCY agar medium and incubated at 29°C for 2 days. Production and further solubilization of the Bt crystal proteins was performed as described by Estela et al., (2004). Protein concentration was determined by Bradford assay (Bradford, 1976). Protoxin activation was carried out by adding 10% trypsin (w/w) and incubating the sample for 2 hours at 37°C. Solubilized and trypsin activated proteins were analyzed by sodium dodecyl sulphate 12% polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli 1970. - Cry proteins expression, purification and trypsin activation The Cry1Ab protein (used as a control in this study), was obtained from a recombinant E. coli strain GG094-208 (from Dr. R.A. de Maagd, Wageningen University, The Netherlands). The Cry1Ia7 protein originally obtained from a Spanish strain of Bt, HU4-2 (Martínez et al., 2004), was kindly provided by Dr. Primitivo Caballero (Universidad Pública de Navarra, Pamplona, Spain). The Cry1Ia38, Cry1Ia38-I116V and Cry1Ia7 proteins were expressed in the recombinant E. coli, BL21 (DE3) cells. The Cry1Ab protein expression, inclusion bodies purification, solubilization and protoxin activation by trypsin was performed as described previously (Sayyed et al., 2005). To obtain the main fragment corresponding to Cry1Ab activated toxin, anion-exchange chromatography in a MonoQ 5/5 column using Äkta 100 explorer system (GE Healthcare, United Kingdom) was performed. The eluted fractions from the column were individually analysed by sodium dodecyl sulphate 12% polyacrylamide gel electrophoresis (SDS-PAGE). The expression of Cry1Ia38, Cry1Ia38-I116V and Cry1Ia7 proteins in the recombinant E. coli, BL21 (DE3) cells, affinity purification using a HisTrapTM FF crude column (GE Healthcare Bio-Sciences, Upsala, Sweden), protein dialysis and protoxin activation by trypsin were performed as reported by Khorramnejad et al., (2018). The concentration of Cry1Ab, Cry1Ia38, Cry1Ia38-I116V and Cry1Ia7 proteins were estimated by densitometry using TotalLab Quant program version 12.3, employing bovine serum albumin, as a standard protein. Specific Methodology: First part: B. thuringiensis strains characterization Iranian Bt strains isolation The acetate selective method was used to isolate, initially, the Bt strains. In this method, sodium acetate (0.25 mM) selectively inhibits the germination of Bt spores not that of other spore-formers, thus the germinated spores and other non-spore forming bacteria were eliminated by following heat treatment, 7 min at 80 ̊C. Then samples were plated on nutrient agar and allowed to grow overnight at 29°C. Colonies resembling Bt were examined for gram staining and the presence of parasporal crystals were observed by phase contrast microscopy. The Bt isolates were detected based on the capacity of producing parasporal crystal inclusions. - Bioassay experiments Preliminary selection of insecticidal Bt strains was performed recording the toxicity of the 130 native Bt strains against second instar larvae of P. interpunctella. The screening bioassays were performed with a single discriminating concentration of 108 cells/ml (higher than the calculated LC50) against P. interpunctella larvae by food incorporation method. Assays were carried out using 20 second instar larvae of Indian meal moth per concentration, with three replicates. Water was used as a negative control. Mortality was recorded after 72 hours treatment. Based on this screening, seven Bt strains with different larvicidal activity were selected and bioassayed against neonates of S. exigua, G. molesta, O. nubilalis and M. brassicae by surface contamination method as described by Hernández-Martínez et al., 2008. Bioassay experiments were performed with protoxins and activated toxins, and were repeated three times with 48 larvae in each replicate. The solubilization buffer and HD1were used as negative control and reference strain, respectively. Bioassays were conducted at 25 ± 1°C, 60 ± 5% RH and 16:8 L/D photoperiod. Mortality was scored after 7 days. - Cell viability assays Cell viability was assayed using CellTiter 96® AQueous One Solution Reagent (Promega Co., Madison, WI, USA) based on tetrazolium salt (MTT- 3-(4,5-Dimethyl-2-thiazolyl) 2,5-diphenyl-2H-tetrazolium bromide) reduction method. The cell viability assay, as a less cost, time and material consuming technique, was performed using four lepidopteran cell lines from T. ni (Hi5), H. zea (HzGUT), S. exigua (UCR-SE) and S. frugiperda (Sf21). The cytocidal activity was investigated by microscopic observation, single-dose assay and dose-response assay. A single-dose assay was carried out with solubilized and trypsin activated proteins to determine the cytotoxic activity of all selected Bt strains against the four different insect cell lines. Subsequently, dose-response assays were performed for the most toxic strains against the most susceptible insect cell lines. For the single-dose assays, 10 µl of either solubilized protein (at a concentration of 1 µg/µl) or trypsin activated toxin (at a concentration of 7 µg/µl), were used. For dose-response assay, cells were treated with trypsinized protein at different concentrations, from 0.64, 3.2, 16, 80 to 400 µg/ml. Morphological changes induced by toxins were recorded after observation with an inverted microscope (Leica DMI 3000B), at the time intervals of 1, 3, 6 and 16 hours after exposure to toxin. Cell viability was measured 16 hours after treating the cells in the single-dose assays, and 6 hours after exposure in dose-response assays. All experiments were performed in duplicate and repeated twice. - Protein profile and proteomic analysis Solubilized and trypsin activated proteins were analyzed by sodium dodecyl sulphate 12% polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli 1970. Liquid chromatography and tandem mass spectrometry (LC–MS/MS) was performed at the proteomics facility of the SCSIE (Servei Central de Suport a la Investigació Experimental), at the University of Valencia, Valencia, Spain. The insecticidal crystal proteins produced by each one of the Bt strains were analyzed by LC–MS/MS. - Gene content identification The total DNA from the selected Bt strains was extracted and purified following Ferrandis et al. (1999). Bt strains were characterized by using 27 pairs of primers designed in this work or previously described in the bibliography. PCR products were analyzed by 1% agarose gel electrophoresis. The amplified DNA was purified using NucleoSpin Gel and PCR Clean-up kit (MACHEREY-NAGEL, Germany) and sent to Stab Vida (Investigação e Serviços em Ciências Biologicas Lda, Portugal) for sequencing. The sequences were edited and analyzed using Geneious software (version 10.0.9). The DNA sequence analyses including alignment and blast were performed using the NCBI database. - Β-exotoxin production The possible presence of β-exotoxin in the Bt strains was also determined by LC-MS/MS. Sample preparation was done as described by Hernández et al. 2003. Second part: Expression, isolation and purification of new insecticidal protein IE-1 Bt strain isolated from infected Ephestia kuehniela larvae was characterized deeply according to its gene content and crystal protein composition. In the investigation of gene contents of Bt strains, new cry1Ia-type gene was found in the Bt IE-1 strain. It was named cry1Ia38 (Gene Bank Acc. Number MG584186). - Cloning of cry1Ia38 gene The full-length cry1Ia38 gene was cloned from extracted genomic DNA of IE-1 Bt strain. The primers used for amplification of cry1Ia38 gene by PCR were Ia38-F (5´GGATCCATGAAACTAAAGAATCAAGAT 3´) and Ia38-R (5´ GTCGACCTACATGTTACGTTACGCTCAATC 3´). After amplification, full-length PCR products were cloned into a cloning vector, pGEM-Teasy. Later, the cloned cry1Ia38 gene was sub-cloned into the expression vector, pET-30a(+). The resulting construct was transformed into E. coli DHα5 cells. The correct sequence of generated amplicon was confirmed by sequencing with insert primers, in both directions. After sequencing, successful transformants were transformed into E. coli BL21 (DE3) cells for protein expression. The expressed Cry1Ia38 protein was purified with Ni2+ affinity chromatography due to the histidine tag, as explained in “Expression, purification and trypsin activation of Cry proteins” part. - Site-directed mutagenesis The substitution of the Ile116 by Val at the position 116 in domain I was obtained by overlap-extension PCR, using cry1Ia38 gene cloned into pET-30a(+) as a template. DNA sequencing at the STABVIDA verified the single point mutation. Therefore, Cry1Ia38-I116V mutant was generated by site-directed mutagenesis. Third part: Assessment of insecticidal and cytocidal activity of Cry1Ia toxins The molecular characterization, insecticidal and cytocidal activities of Cry1Ia38 protoxin and trypsin activated protein were studied in this research against O. nubilalis, G. molesta, H. armigera, S. exigua and S. littoralis neonates, at the concentration of 1000 ng/cm2. The cytotoxic activity of Cry1Ia38 protoxin and trypsin activated toxin was also determined against Sf21 cell line, at four different concentrations (0.16, 0.8, 4 and 20 µg/ml). The insecticidal activity of protoxin and trypsin activated toxin of Cry1Ia38-I116V protein was assessed against O. nubilalis, S. exigua, G. molesta and S. littoralis neonates at the concentration of 1000 ng/cm2, by surface contamination method. The cytotoxic activity of Cry1Ia38-I116V protoxin and trypsin activated toxin was also determined against Sf21 cell line, at four different concentrations (0.16, 0.8, 4 and 20 µg/ml). To compare the insecticidal activity of Cry1Ia38 with other Cry1Ia proteins, Cry1Ia7 toxin has been selected. The Cry1Ia7 protein, had deeply been analyzed previously and was available as a cloned gene in Biotechnological Control of Pest Laboratory, Genetic Department at the University of Valencia (laboratory where this PhD work has been partially accomplished). The amino acid sequence of Cry1Ia38 is 96% identical to Cry1Ia7 protein. The insecticidal activity of Cry1Ia7 protein originally obtained from a Spanish Bt strain HU4-2, was assessed against O. nubilalis, G. molesta, M. brassicae and S. littoralis first instar larvae at a concentration of 1000 ng/cm2. The cytotoxic activity of Cry1Ia7 toxins at four different concentrations (0.16, 0.8, 4 and 20 µg/ml) was also evaluated against two lepidopteran cell lines, Sf21 and Hi5. Forth part: Studying the oligomerization step in mode of action Cry1Ia proteins - Cry1Ia biotin labelling Trypsin activated Cry1Ia protein was biotinylated by using the protein biotinylation kit from GE Healthcare (GE Healthcare, Little Chalfont, United Kingdom) according to the manufacturer’s instructions, as described elsewhere (Hernández-Martínez et al., 2014). - Oligomerization assays with Sf21 cells The oligomerization assays were performed as described by Portugal et al (2014) with slight modifications. In short, 100 µl of cell suspension by the concentration of 2×106 cells/ml were treated with final concentration of 0.03 µg protein/µl of activated toxins (biotinylated Cry1Ia and unlabelled Cry1Ab). The plates were incubated for 3 hours at 25°C. After the incubation, the treated cells were collected and pelleted by centrifugation at 16,200 ×g, 4°C for 15 min. After washing the pellet with 200 µl of 50 mM carbonate buffer pH 10.5, the Sf21 cells (in the pellet) were recovered by centrifugation 45 min at 18,800 ×g. The final pellet was resuspended 10 µl of buffer and heated at 50 ◦C for 3 min. The proteins present in the sample were separated by SDS-PAGE 10% and electrotransferred onto polyvinylidene difluoride (PVDF) membrane. The membrane was incubated overnight in blocking buffer (PBST; 0.1% Tween 20 in phosphate-buffered saline supplemented with 5% skimmed milk) with gentle shaking, and washed three times with PBST before incubation with antibodies. Cry1Ab protein was detected with polyclonal rabbit anti-Bt Cry1Ab/1Ac (1:10,000; 60 min) from Abraxis (Warminster, Pennsylvania, United States) followed by secondary antibody (1:20,000; 60 min) coupled with horseradish peroxidase (HRP), whereas biotinylated Cry1Ia protein was detected by streptavidin-conjugated horseradish peroxidase (1:2,000; 60 min). Both Cry1Ab and Cry1Ia proteins were visualized by chemiluminescence using ECLTM prime western blotting detection regent (GE Healthcare) using an ImageQuant LAS400 image analyzer. The molecular weight marker used was Precision Plus Protein™ Dual Color Standard (Bio-Rad, Carlsbad, CA). Each oligomerization assay was repeated at least three times. - Oligomerization assays with BBMV The oligomerization assays with BBMV were performed following Ocelotl et al (2015) with some modifications: 2 µg of biotin labelled Cry1Ia and activated Cry1Ab toxins were incubated for one hour with 5 µg of L. botrana or L. decemlineata BBMV, or with 20 µg of O. nubilalis BBMV, at 37°C, in a final volume of 50 μl. Activated proteins incubated in the absence of BBMV and samples containing only BBMV were used as controls. The rest of experiment was carried out as explained in the previous section. These experiments were repeated, at least, three times. Fifth part: Evaluating the antimicrobial activity of Bt strains The inhibitory effect of seven previously fully characterized Bt strains was assessed against phytopathogenic fungi, F. oxysporum subsp. lycopersici, and bacterium Erwinia spp. Initially, the presence of endo- and exo-chitinase genes was studied by PCR amplification using two pairs of specific primers. The antibacterial activity of seven Bt strains against Erwinia spp. was tested using plug diffusion method as described by Djenane et al., (2017). The antifungal activity of Bt strains against F. oxysporum subsp. lycopersici was studied using dual culture method (Knaak et al., 2007). Sixth part: Determining the biochemical effects of Bt strains on plant cells - Plant growth and bacterial inoculation Tomato plants, Solanum lycopersicum L. (Falat cultivar) were grown in an autoclaved and sterile soil in greenhouse under controlled conditions (25 ± 5°C, 16L:8D hours photoperiod, 65 ± 5% RH). After two weeks, tomato seedlings were transferred to plastic pots with two plants per pot and watered daily with tap water. Later, six-week old plants were split into four groups; 1. Rhizosphere inoculation, 2. Control plant which received sterile distilled water in the rhizosphere, 3. Phylloplane inoculation and 4. Control plants which the phylloplane was sprayed with sterile distilled water. In two treatments, plants were inoculated by the mixture of spores and crystals of AzLp Bt strain at the concentration of 108 spore/ml, through spraying the phylloplane and/or inoculating the rhizosphere. In rhizosphere inoculation treatment, 5-ml of a 108 spore/ml suspension of AzLp Bt strain was applied with a pipette near the roots of each plant in the pot. In the phylloplane inoculation treatment, the soil was covered with plastic to prevent the transference of Bt suspension to the soil. The phylloplane of tomato plants were sprayed with 108 spore/ml suspension of AzLp Bt strain till run-off. In this experiment, 28 tomato pots were used in each treatments, all together 96 tomato pots were employed. After 0 (2 hours after Bt application was considered as 0 day), 1, 2, 3, 5, 7, 10 and 15 days post treatment, mature leaves were collected and completely ground in liquid nitrogen. The leaf powder samples were kept at -80 °C till use. - Tomato plants biochemical and physiological responses The enzymatic activities (catalase, superoxide dismutase, ascorbate peroxidase, phenylalanine ammonia-lyase and polyphenol oxidase) and non-enzymatic parameters (protein, carbohydrate, phenylalanine and phenolic contents) were determined and compared in treated and non-treated leaves. For measuring the enzymatic activity, 0.5 g of the leaf sample was homogenized in one ml of 50 mM phosphate buffer pH 6.8 followed by centrifugation at 13000 ×g, for 15 min at 4 °C. The obtained supernatant was used as enzyme extract and used for determination of catalase (Aebi 1984), superoxide dismutase (Beauchaup and Fridovich, 1971), ascorbate peroxidase (Ranieri et al., 2003) and polyphenol oxidase (Kar and Mishra, 1976). The activity of phenylalanine ammonia-lyase was measured following Wang et al., (2006) protocol. The proline content in the leaf samples was determined by using acid ninhydrin (Carillo and Gibon, 2011). Estimation of the total phenolic content was performed by using Folin-Ciocalteu reagent (Ainsworth and Gillespie, 2007). The protein content (Bradford, 1976) and the total soluble carbohydrate (Dreywood, 1946) in tomato leaves were measured as described elsewhere.   Results and Discussion First part: B. thuringiensis strains characterization A total number of 130 Iranian Bt strains were used in this study: 88 Bt strains came from a Bt stock of Biological Control Laboratory in the University of Tehran, and 42 Bt strains were isolated from soil and infected insect larvae collected from environmentally diverse sources in Iran. Preliminary screening tests were performed with mixtures of spores and crystals on P. intenpunctella second instar larvae. Based on the results, the 130 Bt strains were classified regarding to their toxicity in three different virulence groups; high, medium and low. All the five Bt strains isolated from infected larvae (IE-1, AzLp, IE-2, IP-2 and IEp), as well as, two other Bt strains isolated from soil (DCf and MCh), were categorized in the most toxic group, causing a mortality of more than 67%. In spite of using high concentration, most strains (119 Bt strains) did not cause significant mortality (less than 34%) and only four strains showed moderate activity (34% to 67% mortality). From these results, seven Bt strains with diverse larvicidal activity against P. interpunctella were selected and characterized in more detail in the present work. The selected strains were: IE-1, AzLp, IE-2, IP-2 and IEp, highly toxic for Indian meal moth larvae, and KhF and RM Bt strains which showed respectively, low and non-toxic activity against P. interpunctella. The spectrum of lepidopteran toxic activity was assessed against S. exigua, M. brassicae, G. molesta and O. nubilalis that represent four different families, Noctuidae, Tortricidae, Crambidae and Pyralidae of order Lepidoptera. The susceptibility of the lepidopteran pests to the solubilized and trypsin activated crystal proteins at a single concentration of 1000 ng/cm2, was evaluated by surface contamination method using first instar larvae. Two species, namely G. molesta and O. nubilalis, were the most susceptible insects to both, the protoxins and the trypsin activated toxins. Various degrees of mortality were found in S. exigua and M. brassicae neonates treated with the selected strains. Among those, AzLp, IE-2 and IP-2 protoxins and activated toxins, exhibited the highest levels of toxicity for S. exigua and M. brassicae, compared to those of the standard reference Bt (HD-1-S-2005). To complete the analysis of the insecticidal activity, in vitro toxicity assays with lepidopteran cell lines (cytocidal activity) were performed. According to the effect of Bt toxins on cultured insect cells from family Noctuidae, (order Lepidoptera), crystal proteins from AzLp, IE-2 and IP-2 were the most toxic for all tested cells especially for Sf21. In vitro assays indicated that IE-1 and RM strains were the least toxic for all the tested cell lines, as the reference strain HD-1. Moreover, morphological changes including osmotic swelling and balloon-shaped cells, were observed in Sf21 cells after exposing to different concentrations of AzLp. IE-2 and IP-2 trypsin activated toxins. The result of dose-response assays showed that by increasing the concentration of trypsin activated toxin, viability of Sf21 cells decreased. IE-2 and IP-2 Bt strains exhibited a similar cytotoxic activity, statistically similar EC50 values (1.03 and 1.60 µg/ml, respectively). According to our findings, the selected Bt strains showed similarity in their SDS-PAGE and protein profile, composed of proteins with molecular weights between 130 and 20 kDa. The protein compositions resembled that of Bt subsp. kurstaki (HD-1) and consisted of two major bands of 130 and 60 kDa. The most common pattern was composed of proteins around 130 kDa in size, corresponding to Cry1-type proteins. Parasporal inclusions from strains IE-1, IP-2 and IEp showed a distinct additional band by the weight of 65 to 75 kDa corresponding, most probably, to cry2-type proteins. After solubilization, proteins were treated with 10% trypsin (w/w) for activation. SDS-PAGE profiles of the activated toxins were almost identical for all strains and showed two major bands of about 65 kDa. The LC-MS/MS analysis (which served as a confirmation of the transcription of the previously detected genes) showed that Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ca, Cry1Da and Cry2Aa proteins were the most abundant proteins in the solubilized crystals of the selected Bt strains. The proteins from the Cry1A family were the most abundant ones according to quantitative values. Cry1Ac was the only protein assigned to RM strain. For KhF strain, no protein similar to the known Bt insecticidal crystal proteins were identified. PCR analysis was carried out to identify the genes encoding the Bt proteins, including both the ones secreted during vegetative step of Bt (cry1I, vip and sip genes) and the ones present in the crystals (cry, cyt and ps genes). Positive amplification of cry2 gene was observed in all tested strains. Excluding KhF, the other strains yielded the expected amplicons (based on the results obtained in the SDS-PAGE analysis) for cry1 genes. Strains IE-1, AzLp, IE-2, IP-2 and IEp showed positive PCR amplification of the predicted bands for cry1Ac, cry1I, vip3 genes. None of the strains showed amplification for cry1Ad, cry1Ag, cyt1, cyt2, vip1, vip2, sip1, ps1, ps2, ps3 and ps4 genes. As a final step in the characterization of the selected strains, the production of β-exotoxin was investigated as a necessary requirement to propose a new Bt strain as a candidate for commercial use. The β-exotoxin (an ATP analog) shows toxicity to vertebrates. Then, bioinsecticides based on Bt producing β-exotoxin are prohibited by law in many countries. The presence of β-exotoxin was determined in the supernatant of liquid culture of Bt strains by LC-MS/MS and results showed absence of type I β-exotoxin in all the selected Bt strains, making them suitable as candidates for future biopesticides. In brief, of a total of 130 Bt Iranian strains, 7 were selected to be thoroughly characterized by employing different methods. As a result, due to high toxicity towards different lepidopteran insect larvae and insect cell lines, the presence of the insecticidal proteins, and the absence of β-exotoxin, three Bt strains; AzLp, IE-2 and IP-2, were introduced as suitable candidates for development of Bt based bio-insecticides. Second part: Expression, isolation and purification of new insecticidal protein Because of the extensive application of Bt-based products, resistance has been reported in some insects. Many strategies have been employed to improve the efficacy of Bt-based insecticides and to overcome the resistance evolution. Identification of native Bt strains are needed to discover novel toxins, with different mode of action and broader range of insecticidal activity. In the search for novel cry genes encoding new toxins within the Iranian Bt strains, a new cry1Ia-type gene was found in the Bt IE-1 strain. It was named cry1Ia38 (Gene Bank Acc. Number MG584186). The cry1Ia38 gene comprised a 2160 bp open reading frame encoding a protein of 719 amino acids. In the present work, the full-length cry1Ia38 gene was cloned from the genomic DNA extracted from the IE-1 Bt strain. The isolated gene was expressed in Escherichia coli BL21 (DE3) cells. That cry1Ia38 gene encoded an 80-kDa protein, a molecular mass unique amongst the 3D proteins and common to all the Cry1I toxins. Trypsin-activation of Cry1Ia38 resulted in a 50-kDa peptide stable form. Moreover, the toxicity of a Cry1Ia38 mutant with a single point mutation (Cry1Ia38-I116V) was compared with that of Cry1Ia38 wild-type. The Cry1Ia38-I116V mutant was generated by site-directed mutagenesis, and exhibits substitution at the position 116, resulting in a single replacement of the Ile116 by Val at domain I. The effect of this amino acid substitution was studied in molecular characterization, insecticidal and cytocidal activities. The Cry1Ia38-I116V mutant expression was resulted in 80-kDa protoxin. A band of almost 50-kDa was observed following SDS-PAGE of trypsin activation of Cry1Ia38-I116V protein. Third part: Assessment of insecticidal and cytocidal activity of Cry1Ia toxins According to bioassay results, the purified Cry1Ia38 protoxin showed high toxicity to O. nubilalis and G. molesta, low toxicity to S. exigua and S. littoralis, and non-toxic activity to H. armigera first instar larvae. The trypsin activated Cry1Ia38 was only highly toxic for G. molesta larvae and moderately toxic for O. nubilalis neonates. Based on the result of cell viability assay, Cry1Ia38 protein was not toxic for Sf21 cells at the tested concentrations. No statistically significant differences in viability percentage of Sf21 cells was observed after exposure to protoxin and trypsin activated toxin of Cry1Ia38 protein. The insecticidal activity of Cry1Ia38-I116V protoxin and trypsinized protein with a molecular weight of 80 kDa and 50 kDa respectively were determined against O. nubilalis, G. molesta and S. exigua and S. littoralis larvae with a concentration of 1000 ng/cm2. The Cry1Ia38-I116V protoxin was toxic for O. nubilalis and G. molesta neonates while, the trypsin activated constructed mutant lost the toxicity against both of them. Therefore, the data indicate, single point mutation affected the insecticidal activity of Cry1Ia38 wild-type. Similarly to what had been found in cytocidal activity of Cry1Ia38 protein, Cry1Ia38-I116v protoxin and trypsin activated toxins were not toxic for Sf21 cells. The molecular characterization, insecticidal and cytocidal activities of Cry1Ia7 were compared to the closely related Cry1Ia proteins obtained in the present work (the Cry1Ia38 and Cry1Ia38-I116V proteins). Based on our results, protoxin and trypsin activated Cry1Ia7 were toxic to O. nubilalis. The result of cell viability assay showed that Cry1Ia7 was not toxic for Sf21 and Hi5 cells at the tested concentrations. No statistically significant differences were observed between viability of Sf21 and Hi5 cells. Only after 48 hours of exposure to the highest concentration of activated Cry1Ia7 (20 μg/ml), a 40% loss of cell viability was observed in both insect cell lines. In summary, in this research the insecticidal spectrum of different Cry1Ia proteins was assessed and compared. According to our findings, protoxins of Cry1Ia38 and Cry1Ia7 were toxic to O. nubilalis and G. molesta larvae. But trypsin activated Cry1Ia7 showed no insecticidal activity against G. molesta larvae whereas Cry1Ia38 did. Taken together, although there is a high identity between amino acid sequences of the tested Cry1Ia proteins, significant differences were detected in insecticidal activity of the trypsin activated forms of these toxins against G. molesta neonates since G. molesta first instar larvae were susceptible only to the trypsin activated of Cry1Ia38 wild type. Forth part: Studying the oligomerization step in mode of action Cry1Ia proteins Insecticidal activity of Cry Bt toxins relies on the ingestion of parasporal crystalline inclusions to reach to the midgut epithelium. Once ingested by the susceptible larvae, parasporal crystals dissolved by the pH conditions of the midgut and converted to protoxins. The solubilized protoxins are cleaved by host midgut proteases yielding protease resistant core. According to the sequential binding model, after this proteolytic activation, monomers bind to cadherin receptors in the surface of the insect midgut cells. This binding triggers the second proteolytic cleavage that leads to toxin oligomerization, membrane insertion and pore formation. The formation of an oligomeric structure prior to the insertion of the toxin into the insect midgut membrane has been described as a major step necessary for the toxicity process in the mode of action of three domain Cry proteins which compose the Bt parasporal crystal. Due to specific features of Cry1I proteins, a better understanding of their mode of action is critical for enhancing their efficacy against their target insect pests. In this study, the Cry1Ia oligomer formation and the dependency of the insecticidal activity of Cry1Ia on the oligomerization have been determined for the first time. Since Cry1I proteins have dual activity against lepidopteran and coleopteran pests, the oligomer formation of Cry1Ia was studied after incubation of the protein with brush border membrane vesicles (BBMV) of coleopteran susceptible host, Leptinotarsa decemlineata, and lepidopteran susceptible Lobesia botrana, and non-susceptible O. nubilalis insects. Moreover cultured insect cells, Sf21 cell line, as another cell-derived model, was employed in this study. To perform this study, Cry1Ab has been selected to be used as control because its oligomerization has been reported in several studies. Therefore, Cry toxins oligomerization was studied in two proteins, Cry1Ab and Cry1Ia. Our results clearly showed that that Cry1Ab can oligomerize in the proposed tetramer form (250 kDa molecular weight size) regardless to its host susceptibility, as oligomers were observed after incubation of the tripsinized protein with O. nubilalis or L. botrana BBMV (susceptible insects), but also with L. decemlineata BBMV (non-susceptible insect) and Sf21 cells (non-susceptible cultured cells). But Cry1Ia toxin formed oligomers only after incubation with L. decemlineata BBMV (coleopteran susceptible host) but not following incubation with lepidopteran BBMV or Sf21 cells, regardless to its susceptibility. Based on our results, sequential binding model of the three-domain Bt toxins mode of action, followed by toxin oligomerization, may not be widely generalized for all three-domain Cry family members. These data indicate the feasibility of employing Cry1Ia toxins (due to their different mode of action) pyramided with other Cry toxins in Bt-based insecticides or transgenic plants, to delay the evolution of insect resistance. Fifth part: Evaluating the antimicrobial activity of Bt strains Previously, only the insecticidal properties of Bt attracted extensive attention. However, in recent years, the roles of Bt in plant disease control have been found out. Finding a specific, easily degradable and low cost Bt-based formulation as an alternative to chemical pesticides, for controlling both insect pests and plant diseases, would be highly valuable in biological control. There are evidences of an antibiotic action of spores and crystals of Bt strains on phytopathogenic fungi and bacteria. In this study the antimicrobial activity of the seven previously characterized Bt strains was assessed against plant pathogens such as the fungus F. oxysporum or the bacteria Erwinia sp.. Further, chitinase gene, as an important antifungal agent, was traced in the studied Bt strains. According to our findings, IE-1, AzLp, IE-2, IP-2 and IEp Bt strains possessed exo-chitinase. The endo-chitinase gene was present in AzLp, IE-2 and IP-2 Bt strains. The antifungal activity of the seven Bt strains was assessed against F. oxysporum subsp. lycopersici causing root rot in tomato plants, by the dual culture method. The phytopathogenic fungus grew on the surface of Potato Dextrose Agar plate and the presence of bacterial plugs did not inhibit the fungus growth. As a result, the mixture of spores and crystals of the selected Bt strains showed no antifungal activity against pathogenic fungus. There was no correlation between the presence of chitinase genes and antifungal activity. This could be explained by a low transcription of the gene or un-transcribed sequences. The antibacterial activity of the seven selected Bt strains was tested against Gram negative plant pathogenic bacterium, Erwinia sp. by the agar plug diffusion method. The phytopathogenic bacteria grew on the whole surface of Nutrient Agar plate and no clear zone around the bacterial plugs was observed indicating that the studied Bt strains could not control Erwinia sp., which causes soft rot disease. The antimicrobial activity of different Bt strains might be a consequence of the adaptation of the strain to its habitat. Therefore, because most of our studied lepidopteran toxic Bt strains (IE-1, AzLp, IE-2, IP-2 and IEp) had been isolated from infected or dead insect larvae, most probably they did not show any antimicrobial activity, against none of the soil-born phytopathogen agents used (F. oxysporum subsp. lycopersici and Erwinia spp). Sixth part: Determining the biochemical effects of Bt strains on plant cells It has been demonstrated that Bt strains have potential to promote plant growth, to improve nutrient uptake and to protect plants under abiotic and biotic stress conditions. Different Bt strains can protect the plants from phytopathogens through siderophores production, chitinase activity, increasing the activities of plant resistance enzymes and induction of systemic resistance. Although pesticides based on Bt have been widely used for years, little is known about the interaction between plant cells and Bt strains. The aim of this part of the thesis was to study plant-Bt interaction at the cellular level, by focussing on the effect of Bt inoculation on plant anti-oxidant status. When plants are subjected to biotic and abiotic stress, there is a production of activated oxygen species that lead to plant cells damage. Therefore, antioxidant enzymes such as catalase, superoxide dismutase, phenylalanine ammonia-lyase and ascorbate peroxidase enzymes are needed to scavenge the reactive oxygen species and restore the plant to the normal conditions. In the present work, as a result, the activity of the studied antioxidant enzymes in both treatments (spraying the phylloplane and inoculating the rhizosphere) increased significantly compared to non-treated plants, most probably to reduce oxidative stress. When plants encounter with biotic stress (such as pathogen invasion), the oxidative bursts (superoxide, hydrogen peroxide and hydroxyl radicals) occur. The oxidative burst triggers plant defence in two phase; phase one is non-specific and happens immediately after pathogen recognition, but phase two is prolonged and leads to disease resistance. In the case of inoculating the tomato plants with mixture of spores and crystals of AzLp Bt strain in both treatments, these two phase were observed. Inoculation of the phylloplane and rhizosphere tomato plants with Bt suspension (mixture of spores and crystals) significantly improved the accumulation of protein, carbohydrate, proline and phenolic contents in tomato leaves compared to the non-inoculated treatment. Non-enzymatic components such as proline act as a main defence against reactive oxygen species. Therefore, increasing the phenolic, carbohydrate, protein and proline contents in treated tomato leaves, decreases the oxidative damage. Altogether according to our observations, the impact of Bt suspension on tomato cells leads to physiological and biochemical responses, and eventually increased the activity of antioxidant enzymes and induced resistance to biotic stress. To summarize, our investigation has deeply characterized some selected Iranian Bt isolates by using different complementary techniques. The characterization was performed based on the protein profile, gene content, proteomics analysis, insecticidal and cytocidal spectrum of activity focusing on four lepidopteran families (Noctuidea, Pyralidae, Tortricidae and Crambidae) and β-exotoxin production. These comprehensive characterization has introduced three highly potent Bt strains for controlling lepidopteran pests. Following the objectives of this thesis, the effect of selected Bt toxins were evaluated on animal cells (insect cell lines), microbial cells (Erwinia sp. and Fusarium cultures) and plant cells (tomato plants). With the aim of finding novel insecticidal activities, the new Bt strains were explored looking for new cry genes. As a result, a new Cry1Ia gene, the cry1Ia38 gene, was discovered, and this gene and a mutant generated were cloned and expressed. The insecticidal and cytocidal activity of Cry1Ia proteins were assessed against different lepidopteran species and insect cell lines. According to our bioassays results, Cry1Ia38 in the form of protoxin or of trypsin activated toxin has a great potential in controlling the lepidopteran pest G. molesta. Ultimately, molecular biology studies were performed to study the occurrence of an oligomerization step in the mode of action of Cry1Ia protein. Our findings clearly demonstrated that oligomerization is not a necessary step in toxicity of Cry1Ia proteins. es_ES
dc.embargo.terms 0 days es_ES
dc.embargo.terms 1 year

View       (18.73Mb)

This item appears in the following Collection(s)

Show simple item record

Search DSpace

Advanced Search

Browse

Statistics